rs772716837
Variant summary
Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1
The NM_001080516.2(GRXCR2):c.726_*2delTTGCCAGATTTGCAATCAATAGCC(p.Pro242_Ter249delins???) variant causes a stop lost, conservative inframe deletion change. The variant allele was found at a frequency of 0.0000198 in 1,613,682 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_001080516.2 stop_lost, conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- autosomal recessive nonsyndromic hearing loss 101Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- nonsyndromic genetic hearing lossInheritance: AR Classification: MODERATE Submitted by: ClinGen
- hearing loss, autosomal recessiveInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001080516.2. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| GRXCR2 | MANE Select | c.726_*2delTTGCCAGATTTGCAATCAATAGCC | p.Pro242_Ter249delins??? | stop_lost conservative_inframe_deletion | Exon 3 of 3 | NP_001073985.1 | A6NFK2 | ||
| GRXCR2 | MANE Select | c.726_*2delTTGCCAGATTTGCAATCAATAGCC | 3_prime_UTR | Exon 3 of 3 | NP_001073985.1 | A6NFK2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| GRXCR2 | TSL:2 MANE Select | c.726_*2delTTGCCAGATTTGCAATCAATAGCC | p.Pro242_Ter249delins??? | stop_lost conservative_inframe_deletion | Exon 3 of 3 | ENSP00000367214.1 | A6NFK2 | ||
| GRXCR2 | TSL:2 MANE Select | c.726_*2delTTGCCAGATTTGCAATCAATAGCC | 3_prime_UTR | Exon 3 of 3 | ENSP00000367214.1 | A6NFK2 | |||
| GRXCR2 | TSL:5 | c.321_*2delTTGCCAGATTTGCAATCAATAGCC | p.Pro107_Ter114delins??? | stop_lost conservative_inframe_deletion | Exon 4 of 4 | ENSP00000491860.1 | A0A1W2PQQ7 |
Frequencies
GnomAD3 genomes AF: 0.0000460 AC: 7AN: 152150Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.0000279 AC: 7AN: 251190 AF XY: 0.0000221 show subpopulations
GnomAD4 exome AF: 0.0000171 AC: 25AN: 1461532Hom.: 0 AF XY: 0.0000234 AC XY: 17AN XY: 727088 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000460 AC: 7AN: 152150Hom.: 0 Cov.: 32 AF XY: 0.0000538 AC XY: 4AN XY: 74316 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at