5-168431457-TCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGG-TCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGG

Variant names:

• chr5-168431457-T-TCTGGCTGGCTGGCTGGCTGGCTGGCTGG
• NM_015238.3:c.2280+33_2280+60dupGCTGGCTGGCTGGCTGGCTGGCTGGCTG

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 0P and 0B.

The NM_015238.3(WWC1):​c.2280+33_2280+60dupGCTGGCTGGCTGGCTGGCTGGCTGGCTG variant causes a intron change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: 𝑓 0.0000067 (0 hom., cov: 0)
• Consequence: WWC1 NM_015238.3 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: -0.765

Genes affected

WWC1 (HGNC:29435): (WW and C2 domain containing 1) The protein encoded by this gene is a cytoplasmic phosphoprotein that interacts with PRKC-zeta and dynein light chain-1. Alleles of this gene have been found that enhance memory in some individuals. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]

ACMG classification

Verdict is Uncertain_significance. Variant got 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
WWC1	NM_015238.3	c.2280+33_2280+60dupGCTGGCTGGCTGGCTGGCTGGCTGGCTG		intron_variant	Intron 15 of 22	ENST00000265293.9	NP_056053.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
WWC1	ENST00000265293.9	c.2280+13_2280+14insCTGGCTGGCTGGCTGGCTGGCTGGCTGG		intron_variant	Intron 15 of 22	1	NM_015238.3	ENSP00000265293.4

Frequencies

GnomAD3 genomes AF: 0.00000674 AC: 1 AN: 148354 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000226

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome Cov.: 0

GnomAD4 genome AF: 0.00000674 AC: 1 AN: 148464 Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0 AN XY: 72196

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.000226

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr5-167858462;