chr5-168431457-T-TCTGGCTGGCTGGCTGGCTGGCTGGCTGG

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_015238.3(WWC1):​c.2280+33_2280+60dupGCTGGCTGGCTGGCTGGCTGGCTGGCTG variant causes a intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

Frequency

Genomes: 𝑓 0.0000067 ( 0 hom., cov: 0)

Consequence

WWC1
NM_015238.3 intron

Scores

Not classified

Clinical Significance

Not reported in ClinVar

Conservation

PhyloP100: -0.765

Publications

0 publications found
Variant links:
Genes affected
WWC1 (HGNC:29435): (WW and C2 domain containing 1) The protein encoded by this gene is a cytoplasmic phosphoprotein that interacts with PRKC-zeta and dynein light chain-1. Alleles of this gene have been found that enhance memory in some individuals. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
WWC1NM_015238.3 linkc.2280+33_2280+60dupGCTGGCTGGCTGGCTGGCTGGCTGGCTG intron_variant Intron 15 of 22 ENST00000265293.9 NP_056053.1 Q8IX03-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
WWC1ENST00000265293.9 linkc.2280+13_2280+14insCTGGCTGGCTGGCTGGCTGGCTGGCTGG intron_variant Intron 15 of 22 1 NM_015238.3 ENSP00000265293.4 Q8IX03-1

Frequencies

GnomAD3 genomes
AF:
0.00000674
AC:
1
AN:
148354
Hom.:
0
Cov.:
0
show subpopulations
Gnomad AFR
AF:
0.00
Gnomad AMI
AF:
0.00
Gnomad AMR
AF:
0.00
Gnomad ASJ
AF:
0.00
Gnomad EAS
AF:
0.00
Gnomad SAS
AF:
0.000226
Gnomad FIN
AF:
0.00
Gnomad MID
AF:
0.00
Gnomad NFE
AF:
0.00
Gnomad OTH
AF:
0.00
GnomAD4 exome
Cov.:
0
GnomAD4 genome
AF:
0.00000674
AC:
1
AN:
148464
Hom.:
0
Cov.:
0
AF XY:
0.00
AC XY:
0
AN XY:
72196
show subpopulations
African (AFR)
AF:
0.00
AC:
0
AN:
40282
American (AMR)
AF:
0.00
AC:
0
AN:
14876
Ashkenazi Jewish (ASJ)
AF:
0.00
AC:
0
AN:
3430
East Asian (EAS)
AF:
0.00
AC:
0
AN:
4972
South Asian (SAS)
AF:
0.000226
AC:
1
AN:
4420
European-Finnish (FIN)
AF:
0.00
AC:
0
AN:
10164
Middle Eastern (MID)
AF:
0.00
AC:
0
AN:
290
European-Non Finnish (NFE)
AF:
0.00
AC:
0
AN:
67104
Other (OTH)
AF:
0.00
AC:
0
AN:
2024
Allele Balance Distribution
Red line indicates average allele balance
Average allele balance: 0.475
Heterozygous variant carriers
0
0
1
1
2
2
0.00
0.20
0.40
0.60
0.80
0.95
Allele balance

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
-0.77

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs11279828; hg19: chr5-167858462; API