5-72887228-CCTAAGTCCAGTTTGAATTATGTAAGTTGGCTTCTTACTACTATTAGGTACTAATAAGGCTAGGCTACTTTAAGG-C

Variant names:

• chr5-72887228-CCTAAGTCCAGTTTGAATTATGTAAGTTGGCTTCTTACTACTATTAGGTACTAATAAGGCTAGGCTACTTTAAGG-C
• rs1561346863
• NM_002270.4:c.1303+7_1303+80delCTAAGTCCAGTTTGAATTATGTAAGTTGGCTTCTTACTACTATTAGGTACTAATAAGGCTAGGCTACTTTAAGG

Variant summary

Our verdict is Likely benign. The variant received -6 ACMG points: 0P and 6B. BP6_Moderate BS2

The NM_002270.4(TNPO1):​c.1303+7_1303+80delCTAAGTCCAGTTTGAATTATGTAAGTTGGCTTCTTACTACTATTAGGTACTAATAAGGCTAGGCTACTTTAAGG variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.137 in 1,587,068 control chromosomes in the GnomAD database, including 18,725 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.14 (1701 hom., cov: 30)
  • Exomes 𝑓: 0.14 (17024 hom.)
• Consequence: TNPO1 NM_002270.4 splice_region, intron
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 1.52
• Publications: 0 publications found

Genes affected

TNPO1 (HGNC:6401): (transportin 1) This gene encodes the beta subunit of the karyopherin receptor complex which interacts with nuclear localization signals to target nuclear proteins to the nucleus. The karyopherin receptor complex is a heterodimer of an alpha subunit which recognizes the nuclear localization signal and a beta subunit which docks the complex at nucleoporins. Alternate splicing of this gene results in several transcript variants encoding different proteins. [provided by RefSeq, Jun 2018]

TNPO1 Gene-Disease associations (from GenCC):

• Tourette syndrome

  Inheritance: Unknown Classification: NO_KNOWN Submitted by: Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Likely_benign. The variant received -6 ACMG points.

• BP6: Variant 5-72887228-CCTAAGTCCAGTTTGAATTATGTAAGTTGGCTTCTTACTACTATTAGGTACTAATAAGGCTAGGCTACTTTAAGG-C is Benign according to our data. Variant chr5-72887228-CCTAAGTCCAGTTTGAATTATGTAAGTTGGCTTCTTACTACTATTAGGTACTAATAAGGCTAGGCTACTTTAAGG-C is described in ClinVar as Benign. ClinVar VariationId is 771379.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS2: High Homozygotes in GnomAd4 at 1701 Unknown gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TNPO1	NM_002270.4	c.1303+7_1303+80delCTAAGTCCAGTTTGAATTATGTAAGTTGGCTTCTTACTACTATTAGGTACTAATAAGGCTAGGCTACTTTAAGG		splice_region_variant, intron_variant	Intron 12 of 24	ENST00000337273.10	NP_002261.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TNPO1	ENST00000337273.10	c.1303+7_1303+80delCTAAGTCCAGTTTGAATTATGTAAGTTGGCTTCTTACTACTATTAGGTACTAATAAGGCTAGGCTACTTTAAGG		splice_region_variant, intron_variant	Intron 12 of 24	1	NM_002270.4	ENSP00000336712.5

Frequencies

GnomAD3 genomes AF: 0.137 AC: 20598 AN: 150208 Hom.: 1701 Cov.: 30

Gnomad AFR AF: 0.120

Gnomad AMI AF: 0.121

Gnomad AMR AF: 0.0981

Gnomad ASJ AF: 0.0619

Gnomad EAS AF: 0.339

Gnomad SAS AF: 0.0560

Gnomad FIN AF: 0.185

Gnomad MID AF: 0.0348

Gnomad NFE AF: 0.145

Gnomad OTH AF: 0.111

GnomAD2 exomes AF: 0.134 AC: 33139 AN: 247172 AF XY: 0.130

Gnomad AFR exome AF: 0.117

Gnomad AMR exome AF: 0.0928

Gnomad ASJ exome AF: 0.0705

Gnomad EAS exome AF: 0.352

Gnomad FIN exome AF: 0.184

Gnomad NFE exome AF: 0.134

Gnomad OTH exome AF: 0.131

GnomAD4 exome AF: 0.137 AC: 197291 AN: 1436742 Hom.: 17024 AF XY: 0.135 AC XY: 96270 AN XY: 715108

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.115 AC: 3801 AN: 32946

American (AMR) AF: 0.0988 AC: 4369 AN: 44232

Ashkenazi Jewish (ASJ) AF: 0.0711 AC: 1833 AN: 25764

East Asian (EAS) AF: 0.361 AC: 13824 AN: 38338

South Asian (SAS) AF: 0.0515 AC: 4400 AN: 85434

European-Finnish (FIN) AF: 0.196 AC: 10231 AN: 52232

Middle Eastern (MID) AF: 0.0535 AC: 306 AN: 5716

European-Non Finnish (NFE) AF: 0.138 AC: 150611 AN: 1092798

Other (OTH) AF: 0.134 AC: 7916 AN: 59282

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.137 AC: 20600 AN: 150326 Hom.: 1701 Cov.: 30 AF XY: 0.138 AC XY: 10097 AN XY: 73408

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.120 AC: 4922 AN: 40998

American (AMR) AF: 0.0980 AC: 1479 AN: 15094

Ashkenazi Jewish (ASJ) AF: 0.0619 AC: 214 AN: 3456

East Asian (EAS) AF: 0.340 AC: 1710 AN: 5036

South Asian (SAS) AF: 0.0559 AC: 267 AN: 4780

European-Finnish (FIN) AF: 0.185 AC: 1925 AN: 10386

Middle Eastern (MID) AF: 0.0374 AC: 11 AN: 294

European-Non Finnish (NFE) AF: 0.145 AC: 9734 AN: 67290

Other (OTH) AF: 0.109 AC: 228 AN: 2084

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

Alfa AF: 0.139 Hom.: 151

Asia WGS AF: 0.173 AC: 602 AN: 3478

ClinVar

Significance: Benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Dec 31, 2019

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.5
Mutation Taster		=100/0	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1561346863; hg19: chr5-72183055; COSMIC: COSV61521626; COSMIC: COSV61521626;