rs1561346863
Variant summary
Our verdict is Likely benign. The variant received -6 ACMG points: 0P and 6B. BP6_ModerateBS2
The NM_002270.4(TNPO1):c.1303+7_1303+80delCTAAGTCCAGTTTGAATTATGTAAGTTGGCTTCTTACTACTATTAGGTACTAATAAGGCTAGGCTACTTTAAGG variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.137 in 1,587,068 control chromosomes in the GnomAD database, including 18,725 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★).
Frequency
Consequence
NM_002270.4 splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- Tourette syndromeInheritance: Unknown Classification: NO_KNOWN Submitted by: Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -6 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_002270.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TNPO1 | NM_002270.4 | MANE Select | c.1303+7_1303+80delCTAAGTCCAGTTTGAATTATGTAAGTTGGCTTCTTACTACTATTAGGTACTAATAAGGCTAGGCTACTTTAAGG | splice_region intron | N/A | NP_002261.3 | |||
| TNPO1 | NM_001364292.3 | c.1279+7_1279+80delCTAAGTCCAGTTTGAATTATGTAAGTTGGCTTCTTACTACTATTAGGTACTAATAAGGCTAGGCTACTTTAAGG | splice_region intron | N/A | NP_001351221.1 | Q92973-2 | |||
| TNPO1 | NM_001364293.3 | c.1279+7_1279+80delCTAAGTCCAGTTTGAATTATGTAAGTTGGCTTCTTACTACTATTAGGTACTAATAAGGCTAGGCTACTTTAAGG | splice_region intron | N/A | NP_001351222.1 | Q92973-2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TNPO1 | ENST00000337273.10 | TSL:1 MANE Select | c.1303+7_1303+80delCTAAGTCCAGTTTGAATTATGTAAGTTGGCTTCTTACTACTATTAGGTACTAATAAGGCTAGGCTACTTTAAGG | splice_region intron | N/A | ENSP00000336712.5 | Q92973-1 | ||
| TNPO1 | ENST00000506351.6 | TSL:1 | c.1279+7_1279+80delCTAAGTCCAGTTTGAATTATGTAAGTTGGCTTCTTACTACTATTAGGTACTAATAAGGCTAGGCTACTTTAAGG | splice_region intron | N/A | ENSP00000425118.2 | Q92973-2 | ||
| TNPO1 | ENST00000944758.1 | c.1369+7_1369+80delCTAAGTCCAGTTTGAATTATGTAAGTTGGCTTCTTACTACTATTAGGTACTAATAAGGCTAGGCTACTTTAAGG | splice_region intron | N/A | ENSP00000614817.1 |
Frequencies
GnomAD3 genomes AF: 0.137 AC: 20598AN: 150208Hom.: 1701 Cov.: 30 show subpopulations
GnomAD2 exomes AF: 0.134 AC: 33139AN: 247172 AF XY: 0.130 show subpopulations
GnomAD4 exome AF: 0.137 AC: 197291AN: 1436742Hom.: 17024 AF XY: 0.135 AC XY: 96270AN XY: 715108 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.137 AC: 20600AN: 150326Hom.: 1701 Cov.: 30 AF XY: 0.138 AC XY: 10097AN XY: 73408 show subpopulations ⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at