5-87268456-TGGCGGCCGAGGCCGGCAGTGAGGAG-T

Variant names:

• chr5-87268456-TGGCGGCCGAGGCCGGCAGTGAGGAG-T
• NM_002890.3:c.13_37delGAGGCCGGCAGTGAGGAGGGCGGCC

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_002890.3(RASA1):​c.13_37delGAGGCCGGCAGTGAGGAGGGCGGCC​(p.Glu5ArgfsTer2) variant causes a frameshift change. The variant allele was found at a frequency of 0.00000287 in 1,394,942 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000029 (0 hom.)
• Consequence: RASA1 NM_002890.3 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 6.91

Genes affected

RASA1 (HGNC:9871): (RAS p21 protein activator 1) The protein encoded by this gene is located in the cytoplasm and is part of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Mutations leading to changes in the binding sites of either protein are associated with basal cell carcinomas. Mutations also have been associated with hereditary capillary malformations (CM) with or without arteriovenous malformations (AVM) and Parkes Weber syndrome. Alternative splicing results in two isoforms where the shorter isoform, lacking the N-terminal hydrophobic region but retaining the same activity, appears to be abundantly expressed in placental but not adult tissues. [provided by RefSeq, May 2012]

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 51 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 5-87268456-TGGCGGCCGAGGCCGGCAGTGAGGAG-T is Pathogenic according to our data. Variant chr5-87268456-TGGCGGCCGAGGCCGGCAGTGAGGAG-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 3256551.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RASA1	NM_002890.3	c.13_37delGAGGCCGGCAGTGAGGAGGGCGGCC	p.Glu5ArgfsTer2	frameshift_variant	Exon 1 of 25	ENST00000274376.11	NP_002881.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RASA1	ENST00000274376.11	c.13_37delGAGGCCGGCAGTGAGGAGGGCGGCC	p.Glu5ArgfsTer2	frameshift_variant	Exon 1 of 25	1	NM_002890.3	ENSP00000274376.6
RASA1	ENST00000515800.6	n.13_37delGAGGCCGGCAGTGAGGAGGGCGGCC		non_coding_transcript_exon_variant	Exon 1 of 26	1		ENSP00000423395.2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 0.00000287 AC: 4 AN: 1394942 Hom.: 0 AF XY: 0.00000582 AC XY: 4 AN XY: 687540

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000371

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Capillary malformation-arteriovenous malformation syndrome Pathogenic:1

Mar 16, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Glu5Argfs*2) in the RASA1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in RASA1 are known to be pathogenic (PMID: 24038909). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with RASA1-related conditions. For these reasons, this variant has been classified as Pathogenic. -

Capillary malformation-arteriovenous malformation 1 Pathogenic:1

Jun 17, 2024

Laboratory of Medical Genetics, National & Kapodistrian University of Athens

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

PVS1, PM2 - The variant is expected to result in an absent or disrupted protein product. Not observed in large population cohorts (gnomAD). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr5-86564273;