NM_002890.3:c.13_37delGAGGCCGGCAGTGAGGAGGGCGGCC

Variant names:

• chr5-87268456-TGGCGGCCGAGGCCGGCAGTGAGGAG-T
• NM_002890.3:c.13_37delGAGGCCGGCAGTGAGGAGGGCGGCC

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_002890.3(RASA1):​c.13_37delGAGGCCGGCAGTGAGGAGGGCGGCC​(p.Glu5ArgfsTer2) variant causes a frameshift change. The variant allele was found at a frequency of 0.00000287 in 1,394,942 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000029 (0 hom.)
• Consequence: RASA1 NM_002890.3 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 6.91
• Publications: 0 publications found

Genes affected

RASA1 (HGNC:9871): (RAS p21 protein activator 1) The protein encoded by this gene is located in the cytoplasm and is part of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Mutations leading to changes in the binding sites of either protein are associated with basal cell carcinomas. Mutations also have been associated with hereditary capillary malformations (CM) with or without arteriovenous malformations (AVM) and Parkes Weber syndrome. Alternative splicing results in two isoforms where the shorter isoform, lacking the N-terminal hydrophobic region but retaining the same activity, appears to be abundantly expressed in placental but not adult tissues. [provided by RefSeq, May 2012]

RASA1 Gene-Disease associations (from GenCC):

• capillary malformation-arteriovenous malformation 1

  Inheritance: AD Classification: DEFINITIVE, STRONG, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics, G2P
• capillary malformation-arteriovenous malformation syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Parkes Weber syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• cardiofaciocutaneous syndrome

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
• Costello syndrome

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
• Noonan syndrome

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
• Noonan syndrome with multiple lentigines

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
• Noonan syndrome-like disorder with loose anagen hair

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
• telangiectasia, hereditary hemorrhagic, type 1

  Inheritance: AD Classification: NO_KNOWN Submitted by: Labcorp Genetics (formerly Invitae)

ENSG00000303897 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 212 pathogenic variants in the truncated region.
• PP5: Variant 5-87268456-TGGCGGCCGAGGCCGGCAGTGAGGAG-T is Pathogenic according to our data. Variant chr5-87268456-TGGCGGCCGAGGCCGGCAGTGAGGAG-T is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 3256551.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_002890.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RASA1	NM_002890.3	MANE Select	c.13_37delGAGGCCGGCAGTGAGGAGGGCGGCC	p.Glu5ArgfsTer2	frameshift	Exon 1 of 25	NP_002881.1	P20936-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RASA1	ENST00000274376.11	TSL:1 MANE Select	c.13_37delGAGGCCGGCAGTGAGGAGGGCGGCC	p.Glu5ArgfsTer2	frameshift	Exon 1 of 25	ENSP00000274376.6	P20936-1
	RASA1	ENST00000515800.6	TSL:1	n.13_37delGAGGCCGGCAGTGAGGAGGGCGGCC		non_coding_transcript_exon	Exon 1 of 26	ENSP00000423395.2	P20936-3
	RASA1	ENST00000888490.1		c.13_37delGAGGCCGGCAGTGAGGAGGGCGGCC	p.Glu5ArgfsTer2	frameshift	Exon 1 of 25	ENSP00000558549.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 0.00000287 AC: 4 AN: 1394942 Hom.: 0 AF XY: 0.00000582 AC XY: 4 AN XY: 687540

African (AFR) AF: 0.00 AC: 0 AN: 31588

American (AMR) AF: 0.00 AC: 0 AN: 35590

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25002

East Asian (EAS) AF: 0.00 AC: 0 AN: 35900

South Asian (SAS) AF: 0.00 AC: 0 AN: 78938

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 48386

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4310

European-Non Finnish (NFE) AF: 0.00000371 AC: 4 AN: 1077560

Other (OTH) AF: 0.00 AC: 0 AN: 57668

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
1	-	-	Capillary malformation-arteriovenous malformation 1 (1)
1	-	-	Capillary malformation-arteriovenous malformation syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr5-86564273;