6-13272859-GGCGGCTGAGCCAGAGGCCAACTGCAGAGGAACTGGAACAGAGGAACATTTTGAAAC-G

Position:

• chr6-13272859-GGCGGCTGAGCCAGAGGCCAACTGCAGAGGAACTGGAACAGAGGAACATTTTGAAAC-G

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_030948.6(PHACTR1):​c.1393_1447+1delCGGCTGAGCCAGAGGCCAACTGCAGAGGAACTGGAACAGAGGAACATTTTGAAACG​(p.Arg465fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: PHACTR1 NM_030948.6 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 8.07

Genes affected

PHACTR1 (HGNC:20990): (phosphatase and actin regulator 1) The protein encoded by this gene is a member of the phosphatase and actin regulator family of proteins. This family member can bind actin and regulate the reorganization of the actin cytoskeleton. It plays a role in tubule formation and in endothelial cell survival. Polymorphisms in this gene are associated with susceptibility to myocardial infarction, coronary artery disease and cervical artery dissection. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2016]

TBC1D7-LOC100130357 (HGNC:):

TBC1D7 (HGNC:21066): (TBC1 domain family member 7) This gene encodes a member of the TBC-domain containing protein family. The encoded protein functions as a subunit of the tuberous sclerosis TSC1-TSC2 complex which plays a role in the regulation of cellular growth and differentiation. Mutations in this gene have been associated with autosomal recessive megalencephaly. Alternative splicing results in multiple transcript variants. Naturally occurring readthrough transcription occurs between this locus and downstream LOC100130357. [provided by RefSeq, Jan 2016]

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
PHACTR1	NM_030948.6	c.1393_1447+1delCGGCTGAGCCAGAGGCCAACTGCAGAGGAACTGGAACAGAGGAACATTTTGAAACG	p.Arg465fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	11/15	ENST00000332995.12	NP_112210.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
PHACTR1	ENST00000332995.12	c.1393_1447+1delCGGCTGAGCCAGAGGCCAACTGCAGAGGAACTGGAACAGAGGAACATTTTGAAACG	p.Arg465fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	11/15	2	NM_030948.6	ENSP00000329880.8

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Developmental and epileptic encephalopathy, 70 Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

New York Genome Center

Dec 13, 2019

The inherited Chr6:13223781-13228362del (c.1392_1477del) identified in the PHACTR1 gene is a single exon deletion of exon 10 (coding exon 10/15), and flanking intronic sequences. This single exon deletion is not present in population databases, and in addition to the deletion of exon 10 this deletion is predicted to lead to an out of frame consequence resulting in a frameshift and premature termination of the protein downstream of its breakpoints. This deletion is not found in ClinVar, and neither this deletion nor similar deletions have been reported in affected individuals in the literature. Exon 10 of the PHACTR1 gene encodes part of the third RPEL domain of the protein, and many of the pathogenic variants in PHACTR1 have been identified within one of the RPEL domains [PMID: 30256902; PMID: 23033978; PMID: 28135719] including p.Asn479Ile in exon 10 [PMID: 30256902]. In vitro studies as well as studies in mouse have suggested that the pathogenic mechanism in PHACTR1 related disorders is loss of function via impaired interactions with actin, which leads to neuronal migration and morphology defects as well as altered neuronal excitability [PMID: 30256902], although this has not been substantiated with additional studies. While the Chr6:13223781-13228362del (c.1392_1477del) variant identified in the PHACTR1 gene leads to a deletion of exon 10, frameshift and premature termination of the protein, sufficient evidence supporting a loss of function mechanism of disease in PHACTR1 related epileptic encephalopathy is lacking, resulting in the current classification of this variant as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1778054792; hg19: chr6-13273091;