6-13283415-CCTGCAGCTCAGTCAAAGGCCCACGGT-C

Position:

• chr6-13283415-CCTGCAGCTCAGTCAAAGGCCCACGGT-C

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_030948.6(PHACTR1):​c.1510-6_1529delCTGCAGCTCAGTCAAAGGCCCACGGT​(p.Leu504fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 31)
• Consequence: PHACTR1 NM_030948.6 frameshift, splice_acceptor, splice_region, intron
• Clinical Significance: Uncertain significance no assertion criteria provided U:1
• Conservation: PhyloP100: 9.96

Genes affected

PHACTR1 (HGNC:20990): (phosphatase and actin regulator 1) The protein encoded by this gene is a member of the phosphatase and actin regulator family of proteins. This family member can bind actin and regulate the reorganization of the actin cytoskeleton. It plays a role in tubule formation and in endothelial cell survival. Polymorphisms in this gene are associated with susceptibility to myocardial infarction, coronary artery disease and cervical artery dissection. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2016]

TBC1D7-LOC100130357 (HGNC:):

TBC1D7 (HGNC:21066): (TBC1 domain family member 7) This gene encodes a member of the TBC-domain containing protein family. The encoded protein functions as a subunit of the tuberous sclerosis TSC1-TSC2 complex which plays a role in the regulation of cellular growth and differentiation. Mutations in this gene have been associated with autosomal recessive megalencephaly. Alternative splicing results in multiple transcript variants. Naturally occurring readthrough transcription occurs between this locus and downstream LOC100130357. [provided by RefSeq, Jan 2016]

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
PHACTR1	NM_030948.6	c.1510-6_1529delCTGCAGCTCAGTCAAAGGCCCACGGT	p.Leu504fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	13/15	ENST00000332995.12	NP_112210.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
PHACTR1	ENST00000332995.12	c.1510-6_1529delCTGCAGCTCAGTCAAAGGCCCACGGT	p.Leu504fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	13/15	2	NM_030948.6	ENSP00000329880.8

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: no assertion criteria provided

Submissions by phenotype

PHACTR1-related disorder Uncertain:1

Uncertain significance, no assertion criteria provided

clinical testing

PreventionGenetics, part of Exact Sciences

Apr 24, 2024

The PHACTR1 c.1720-6_1739del26 variant is predicted to result in a deletion affecting a canonical splice site. This variant is predicted to alter splicing based on available splicing prediction programs (SpliceAI, Jaganathan et al. 2019. PubMed ID: 30661751), however such computer programs are imperfect. To our knowledge, this variant has not been reported in the literature or in gnomAD, indicating this variant is rare. Although we suspect that this variant may be pathogenic, at this time, the clinical significance of this variant is uncertain due to the absence of conclusive functional and genetic evidence. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr6-13283647;