6-170561958-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-ACAGCAGCAGCAGCAGCAGCAGCAG

Variant names:

• chr6-170561958-ACAGCAGCAGCAGCAGCAGCAG-A
• rs752404282
• NM_003194.5:c.261_281delGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. Variant got -1 ACMG points: 0P and 1B. BP3

The NM_003194.5(TBP):​c.261_281delGCAGCAGCAGCAGCAGCAGCA​(p.Gln88_Gln94del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.0000767 in 143,476 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.000077 (0 hom., cov: 21)
  • Exomes 𝑓: 0.00031 (2 hom.)
  • Failed GnomAD Quality Control
• Consequence: TBP NM_003194.5 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 5.03

Genes affected

TBP (HGNC:11588): (TATA-box binding protein) Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes TBP, the TATA-binding protein. A distinctive feature of TBP is a long string of glutamines in the N-terminus. This region of the protein modulates the DNA binding activity of the C terminus, and modulation of DNA binding affects the rate of transcription complex formation and initiation of transcription. The number of CAG repeats encoding the polyglutamine tract is usually 25-42, and expansion of the number of repeats to 45-66 increases the length of the polyglutamine string and is associated with spinocerebellar ataxia 17, a neurodegenerative disorder classified as a polyglutamine disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Likely_benign. Variant got -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_003194.5

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TBP	NM_003194.5	c.261_281delGCAGCAGCAGCAGCAGCAGCA	p.Gln88_Gln94del	disruptive_inframe_deletion	Exon 3 of 8	ENST00000392092.7	NP_003185.1
TBP	NM_001172085.2	c.201_221delGCAGCAGCAGCAGCAGCAGCA	p.Gln68_Gln74del	disruptive_inframe_deletion	Exon 2 of 7		NP_001165556.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TBP	ENST00000392092.7	c.261_281delGCAGCAGCAGCAGCAGCAGCA	p.Gln88_Gln94del	disruptive_inframe_deletion	Exon 3 of 8	1	NM_003194.5	ENSP00000375942.2

Frequencies

GnomAD3 genomes AF: 0.0000767 AC: 11 AN: 143370 Hom.: 0 Cov.: 21

Gnomad AFR AF: 0.0000511

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.000313

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000216

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000110

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000307 AC: 387 AN: 1261632 Hom.: 2 AF XY: 0.000319 AC XY: 201 AN XY: 630674

Gnomad4 AFR exome AF: 0.000104

Gnomad4 AMR exome AF: 0.000263

Gnomad4 ASJ exome AF: 0.000169

Gnomad4 EAS exome AF: 0.000130

Gnomad4 SAS exome AF: 0.000281

Gnomad4 FIN exome AF: 0.0000861

Gnomad4 NFE exome AF: 0.000346

Gnomad4 OTH exome AF: 0.000204

GnomAD4 genome AF: 0.0000767 AC: 11 AN: 143476 Hom.: 0 Cov.: 21 AF XY: 0.0000428 AC XY: 3 AN XY: 70062

Gnomad4 AFR AF: 0.0000510

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.000313

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.000216

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000110

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs752404282; hg19: chr6-170871046;