6-170561958-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Position:

• chr6-170561958-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant summary

Our verdict is Benign. Variant got -7 ACMG points: 0P and 7B. BP3 BP6_Moderate BS2

The NM_003194.5(TBP):​c.276_281dup​(p.Gln94_Gln95dup) variant causes a inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00471 in 1,404,802 control chromosomes in the GnomAD database, including 21 homozygotes. Variant has been reported in ClinVar as Likely benign (★). Synonymous variant affecting the same amino acid position (i.e. Q74Q) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.0042 (2 hom., cov: 24)
  • Exomes 𝑓: 0.0048 (19 hom.)
• Consequence: TBP NM_003194.5 inframe_insertion
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 0.290

Genes affected

TBP (HGNC:11588): (TATA-box binding protein) Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes TBP, the TATA-binding protein. A distinctive feature of TBP is a long string of glutamines in the N-terminus. This region of the protein modulates the DNA binding activity of the C terminus, and modulation of DNA binding affects the rate of transcription complex formation and initiation of transcription. The number of CAG repeats encoding the polyglutamine tract is usually 25-42, and expansion of the number of repeats to 45-66 increases the length of the polyglutamine string and is associated with spinocerebellar ataxia 17, a neurodegenerative disorder classified as a polyglutamine disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Benign. Variant got -7 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_003194.5
• BP6: Variant 6-170561958-A-ACAGCAG is Benign according to our data. Variant chr6-170561958-A-ACAGCAG is described in ClinVar as [Likely_benign]. Clinvar id is 445790.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS2: High Homozygotes in GnomAd4 at 2 AD,AR,Digenic gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
TBP	NM_003194.5	c.276_281dup	p.Gln94_Gln95dup	inframe_insertion	3/8	ENST00000392092.7	NP_003185.1
TBP	NM_001172085.2	c.216_221dup	p.Gln74_Gln75dup	inframe_insertion	2/7		NP_001165556.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
TBP	ENST00000392092.7	c.276_281dup	p.Gln94_Gln95dup	inframe_insertion	3/8	1	NM_003194.5	ENSP00000375942	P2

Frequencies

GnomAD3 genomes AF: 0.00419 AC: 600 AN: 143368 Hom.: 2 Cov.: 24

Gnomad AFR AF: 0.00394

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00355

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00852

Gnomad SAS AF: 0.0130

Gnomad FIN AF: 0.000901

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00436

Gnomad OTH AF: 0.00253

GnomAD3 exomes AF: 0.00435 AC: 651 AN: 149640 Hom.: 1 AF XY: 0.00440 AC XY: 359 AN XY: 81604

Gnomad AFR exome AF: 0.00394

Gnomad AMR exome AF: 0.00281

Gnomad ASJ exome AF: 0.00114

Gnomad EAS exome AF: 0.0137

Gnomad SAS exome AF: 0.0106

Gnomad FIN exome AF: 0.000594

Gnomad NFE exome AF: 0.00325

Gnomad OTH exome AF: 0.00207

GnomAD4 exome AF: 0.00476 AC: 6009 AN: 1261328 Hom.: 19 Cov.: 0 AF XY: 0.00496 AC XY: 3129 AN XY: 630480

Gnomad4 AFR exome AF: 0.00372

Gnomad4 AMR exome AF: 0.00341

Gnomad4 ASJ exome AF: 0.000506

Gnomad4 EAS exome AF: 0.00604

Gnomad4 SAS exome AF: 0.0104

Gnomad4 FIN exome AF: 0.00105

Gnomad4 NFE exome AF: 0.00458

Gnomad4 OTH exome AF: 0.00540

GnomAD4 genome AF: 0.00419 AC: 601 AN: 143474 Hom.: 2 Cov.: 24 AF XY: 0.00387 AC XY: 271 AN XY: 70062

Gnomad4 AFR AF: 0.00392

Gnomad4 AMR AF: 0.00355

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00854

Gnomad4 SAS AF: 0.0130

Gnomad4 FIN AF: 0.000901

Gnomad4 NFE AF: 0.00436

Gnomad4 OTH AF: 0.00300

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Likely benign, criteria provided, single submitter

clinical testing

Center for Pediatric Genomic Medicine, Children's Mercy Hospital and Clinics

Jun 05, 2017

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs752404282; hg19: chr6-170871046;