6-170561958-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Position:

• chr6-170561958-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant summary

Our verdict is Likely benign. Variant got -5 ACMG points: 0P and 5B. BP3 BS2

The NM_003194.5(TBP):​c.273_281dup​(p.Gln93_Gln95dup) variant causes a inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00204 in 1,405,048 control chromosomes in the GnomAD database, including 12 homozygotes. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. Q74Q) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.0018 (2 hom., cov: 24)
  • Exomes 𝑓: 0.0021 (10 hom.)
• Consequence: TBP NM_003194.5 inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.290

Genes affected

TBP (HGNC:11588): (TATA-box binding protein) Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes TBP, the TATA-binding protein. A distinctive feature of TBP is a long string of glutamines in the N-terminus. This region of the protein modulates the DNA binding activity of the C terminus, and modulation of DNA binding affects the rate of transcription complex formation and initiation of transcription. The number of CAG repeats encoding the polyglutamine tract is usually 25-42, and expansion of the number of repeats to 45-66 increases the length of the polyglutamine string and is associated with spinocerebellar ataxia 17, a neurodegenerative disorder classified as a polyglutamine disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Likely_benign. Variant got -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_003194.5
• BS2: High Homozygotes in GnomAd4 at 2 AD,AR,Digenic gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
TBP	NM_003194.5	c.273_281dup	p.Gln93_Gln95dup	inframe_insertion	3/8	ENST00000392092.7	NP_003185.1
TBP	NM_001172085.2	c.213_221dup	p.Gln73_Gln75dup	inframe_insertion	2/7		NP_001165556.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
TBP	ENST00000392092.7	c.273_281dup	p.Gln93_Gln95dup	inframe_insertion	3/8	1	NM_003194.5	ENSP00000375942	P2

Frequencies

GnomAD3 genomes AF: 0.00183 AC: 263 AN: 143376 Hom.: 2 Cov.: 24

Gnomad AFR AF: 0.00148

Gnomad AMI AF: 0.00245

Gnomad AMR AF: 0.00137

Gnomad ASJ AF: 0.00625

Gnomad EAS AF: 0.00386

Gnomad SAS AF: 0.00583

Gnomad FIN AF: 0.00100

Gnomad MID AF: 0.00685

Gnomad NFE AF: 0.00163

Gnomad OTH AF: 0.000506

GnomAD4 exome AF: 0.00206 AC: 2600 AN: 1261566 Hom.: 10 Cov.: 0 AF XY: 0.00211 AC XY: 1329 AN XY: 630614

Gnomad4 AFR exome AF: 0.00142

Gnomad4 AMR exome AF: 0.00127

Gnomad4 ASJ exome AF: 0.00536

Gnomad4 EAS exome AF: 0.00286

Gnomad4 SAS exome AF: 0.00658

Gnomad4 FIN exome AF: 0.00123

Gnomad4 NFE exome AF: 0.00162

Gnomad4 OTH exome AF: 0.00254

GnomAD4 genome AF: 0.00183 AC: 263 AN: 143482 Hom.: 2 Cov.: 24 AF XY: 0.00194 AC XY: 136 AN XY: 70066

Gnomad4 AFR AF: 0.00148

Gnomad4 AMR AF: 0.00136

Gnomad4 ASJ AF: 0.00625

Gnomad4 EAS AF: 0.00386

Gnomad4 SAS AF: 0.00583

Gnomad4 FIN AF: 0.00100

Gnomad4 NFE AF: 0.00163

Gnomad4 OTH AF: 0.000501

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs752404282; hg19: chr6-170871046;