6-170561958-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Position:

• chr6-170561958-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant summary

Our verdict is Likely benign. Variant got -1 ACMG points: 0P and 1B. BP3

The ENST00000392092.7(TBP):​c.267_281dup​(p.Gln91_Gln95dup) variant causes a inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000161 in 1,405,176 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. Q74Q) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.00032 (0 hom., cov: 24)
  • Exomes 𝑓: 0.00014 (0 hom.)
• Consequence: TBP ENST00000392092.7 inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.290

Genes affected

TBP (HGNC:11588): (TATA-box binding protein) Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes TBP, the TATA-binding protein. A distinctive feature of TBP is a long string of glutamines in the N-terminus. This region of the protein modulates the DNA binding activity of the C terminus, and modulation of DNA binding affects the rate of transcription complex formation and initiation of transcription. The number of CAG repeats encoding the polyglutamine tract is usually 25-42, and expansion of the number of repeats to 45-66 increases the length of the polyglutamine string and is associated with spinocerebellar ataxia 17, a neurodegenerative disorder classified as a polyglutamine disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Likely_benign. Variant got -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in ENST00000392092.7

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
TBP	NM_003194.5	c.267_281dup	p.Gln91_Gln95dup	inframe_insertion	3/8	ENST00000392092.7	NP_003185.1
TBP	NM_001172085.2	c.207_221dup	p.Gln71_Gln75dup	inframe_insertion	2/7		NP_001165556.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
TBP	ENST00000392092.7	c.267_281dup	p.Gln91_Gln95dup	inframe_insertion	3/8	1	NM_003194.5	ENSP00000375942	P2

Frequencies

GnomAD3 genomes AF: 0.000321 AC: 46 AN: 143372 Hom.: 0 Cov.: 24

Gnomad AFR AF: 0.000179

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000205

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00101

Gnomad SAS AF: 0.00173

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000345

Gnomad OTH AF: 0.000506

GnomAD4 exome AF: 0.000143 AC: 180 AN: 1261698 Hom.: 0 Cov.: 0 AF XY: 0.000174 AC XY: 110 AN XY: 630694

Gnomad4 AFR exome AF: 0.0000695

Gnomad4 AMR exome AF: 0.000119

Gnomad4 ASJ exome AF: 0.000211

Gnomad4 EAS exome AF: 0.000781

Gnomad4 SAS exome AF: 0.000600

Gnomad4 FIN exome AF: 0.0000430

Gnomad4 NFE exome AF: 0.0000828

Gnomad4 OTH exome AF: 0.000148

GnomAD4 genome AF: 0.000321 AC: 46 AN: 143478 Hom.: 0 Cov.: 24 AF XY: 0.000357 AC XY: 25 AN XY: 70064

Gnomad4 AFR AF: 0.000178

Gnomad4 AMR AF: 0.000205

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00102

Gnomad4 SAS AF: 0.00173

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000345

Gnomad4 OTH AF: 0.000501

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs752404282; hg19: chr6-170871046;