6-170561958-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-ACAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant names:

• chr6-170561958-ACAGCAGCAGCAGCAGCAGCAGCAGCAG-A
• rs752404282
• NM_003194.5:c.255_281delGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Benign. The variant received -7 ACMG points: 0P and 7B. BP3 BP6_Moderate BS2

The ENST00000392092.7(TBP):​c.255_281delGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln86_Gln94del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.00107 in 1,405,038 control chromosomes in the GnomAD database, including 6 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★). Synonymous variant affecting the same amino acid position (i.e. Q85Q) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.0011 (0 hom., cov: 21)
  • Exomes 𝑓: 0.0011 (6 hom.)
• Consequence: TBP ENST00000392092.7 disruptive_inframe_deletion
• Clinical Significance: Benign criteria provided, single submitter B:2
• Conservation: PhyloP100: 5.03
• Publications: 4 publications found

Genes affected

TBP (HGNC:11588): (TATA-box binding protein) Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes TBP, the TATA-binding protein. A distinctive feature of TBP is a long string of glutamines in the N-terminus. This region of the protein modulates the DNA binding activity of the C terminus, and modulation of DNA binding affects the rate of transcription complex formation and initiation of transcription. The number of CAG repeats encoding the polyglutamine tract is usually 25-42, and expansion of the number of repeats to 45-66 increases the length of the polyglutamine string and is associated with spinocerebellar ataxia 17, a neurodegenerative disorder classified as a polyglutamine disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2016]

TBP Gene-Disease associations (from GenCC):

• spinocerebellar ataxia type 17

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Laboratory for Molecular Medicine, Orphanet, Ambry Genetics, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Benign. The variant received -7 ACMG points.

• BP3: Nonframeshift variant in repetitive region in ENST00000392092.7
• BP6: Variant 6-170561958-ACAGCAGCAGCAGCAGCAGCAGCAGCAG-A is Benign according to our data. Variant chr6-170561958-ACAGCAGCAGCAGCAGCAGCAGCAGCAG-A is described in ClinVar as Benign. ClinVar VariationId is 1049045.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS2: High AC in GnomAd4 at 164 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000392092.7. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TBP	NM_003194.5	MANE Select	c.255_281delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln86_Gln94del	disruptive_inframe_deletion	Exon 3 of 8	NP_003185.1
	TBP	NM_001172085.2		c.195_221delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln66_Gln74del	disruptive_inframe_deletion	Exon 2 of 7	NP_001165556.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TBP	ENST00000392092.7	TSL:1 MANE Select	c.255_281delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln86_Gln94del	disruptive_inframe_deletion	Exon 3 of 8	ENSP00000375942.2
	TBP	ENST00000230354.10	TSL:1	c.255_281delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln86_Gln94del	disruptive_inframe_deletion	Exon 3 of 8	ENSP00000230354.5
	TBP	ENST00000421512.5	TSL:1	c.255_281delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln86_Gln94del	disruptive_inframe_deletion	Exon 3 of 5	ENSP00000400008.1

Frequencies

GnomAD3 genomes AF: 0.00114 AC: 164 AN: 143364 Hom.: 0 Cov.: 21

Gnomad AFR AF: 0.000486

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00109

Gnomad ASJ AF: 0.000313

Gnomad EAS AF: 0.000203

Gnomad SAS AF: 0.000432

Gnomad FIN AF: 0.000100

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00191

Gnomad OTH AF: 0.00101

GnomAD4 exome AF: 0.00106 AC: 1335 AN: 1261568 Hom.: 6 AF XY: 0.000978 AC XY: 617 AN XY: 630624

African (AFR) AF: 0.000139 AC: 4 AN: 28776

American (AMR) AF: 0.000382 AC: 16 AN: 41894

Ashkenazi Jewish (ASJ) AF: 0.000295 AC: 7 AN: 23728

East Asian (EAS) AF: 0.00 AC: 0 AN: 38406

South Asian (SAS) AF: 0.0000612 AC: 5 AN: 81728

European-Finnish (FIN) AF: 0.000215 AC: 10 AN: 46476

Middle Eastern (MID) AF: 0.000202 AC: 1 AN: 4954

European-Non Finnish (NFE) AF: 0.00131 AC: 1231 AN: 941712

Other (OTH) AF: 0.00113 AC: 61 AN: 53894

GnomAD4 genome AF: 0.00114 AC: 164 AN: 143470 Hom.: 0 Cov.: 21 AF XY: 0.000971 AC XY: 68 AN XY: 70058

African (AFR) AF: 0.000484 AC: 19 AN: 39242

American (AMR) AF: 0.00109 AC: 16 AN: 14658

Ashkenazi Jewish (ASJ) AF: 0.000313 AC: 1 AN: 3200

East Asian (EAS) AF: 0.000203 AC: 1 AN: 4916

South Asian (SAS) AF: 0.000432 AC: 2 AN: 4628

European-Finnish (FIN) AF: 0.000100 AC: 1 AN: 9992

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 268

European-Non Finnish (NFE) AF: 0.00191 AC: 122 AN: 63752

Other (OTH) AF: 0.00100 AC: 2 AN: 1998

Alfa AF: 0.00 Hom.: 4

ClinVar

ClinVar submissions as Germline

Significance: Benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	2	not provided (2)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.0
Mutation Taster		=149/51	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs752404282; hg19: chr6-170871046;