NM_003194.5:c.255_281delGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chr6-170561958-ACAGCAGCAGCAGCAGCAGCAGCAGCAG-A
• rs752404282
• NM_003194.5:c.255_281delGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Benign. Variant got -7 ACMG points: 0P and 7B. BP3 BP6_Moderate BS2

The NM_003194.5(TBP):​c.255_281delGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln86_Gln94del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.00107 in 1,405,038 control chromosomes in the GnomAD database, including 6 homozygotes. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.0011 (0 hom., cov: 21)
  • Exomes 𝑓: 0.0011 (6 hom.)
• Consequence: TBP NM_003194.5 disruptive_inframe_deletion
• Clinical Significance: Benign criteria provided, single submitter B:2
• Conservation: PhyloP100: 5.03

Genes affected

TBP (HGNC:11588): (TATA-box binding protein) Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes TBP, the TATA-binding protein. A distinctive feature of TBP is a long string of glutamines in the N-terminus. This region of the protein modulates the DNA binding activity of the C terminus, and modulation of DNA binding affects the rate of transcription complex formation and initiation of transcription. The number of CAG repeats encoding the polyglutamine tract is usually 25-42, and expansion of the number of repeats to 45-66 increases the length of the polyglutamine string and is associated with spinocerebellar ataxia 17, a neurodegenerative disorder classified as a polyglutamine disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Benign. Variant got -7 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_003194.5
• BP6: Variant 6-170561958-ACAGCAGCAGCAGCAGCAGCAGCAGCAG-A is Benign according to our data. Variant chr6-170561958-ACAGCAGCAGCAGCAGCAGCAGCAGCAG-A is described in ClinVar as [Benign]. Clinvar id is 1049045.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS2: High Homozygotes in GnomAdExome4 at 6 AD,AR,Digenic gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TBP	NM_003194.5	c.255_281delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln86_Gln94del	disruptive_inframe_deletion	Exon 3 of 8	ENST00000392092.7	NP_003185.1
TBP	NM_001172085.2	c.195_221delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln66_Gln74del	disruptive_inframe_deletion	Exon 2 of 7		NP_001165556.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TBP	ENST00000392092.7	c.255_281delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln86_Gln94del	disruptive_inframe_deletion	Exon 3 of 8	1	NM_003194.5	ENSP00000375942.2

Frequencies

GnomAD3 genomes AF: 0.00114 AC: 164 AN: 143364 Hom.: 0 Cov.: 21

Gnomad AFR AF: 0.000486

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00109

Gnomad ASJ AF: 0.000313

Gnomad EAS AF: 0.000203

Gnomad SAS AF: 0.000432

Gnomad FIN AF: 0.000100

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00191

Gnomad OTH AF: 0.00101

GnomAD4 exome AF: 0.00106 AC: 1335 AN: 1261568 Hom.: 6 AF XY: 0.000978 AC XY: 617 AN XY: 630624

Gnomad4 AFR exome AF: 0.000139

Gnomad4 AMR exome AF: 0.000382

Gnomad4 ASJ exome AF: 0.000295

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.0000612

Gnomad4 FIN exome AF: 0.000215

Gnomad4 NFE exome AF: 0.00131

Gnomad4 OTH exome AF: 0.00113

GnomAD4 genome AF: 0.00114 AC: 164 AN: 143470 Hom.: 0 Cov.: 21 AF XY: 0.000971 AC XY: 68 AN XY: 70058

Gnomad4 AFR AF: 0.000484

Gnomad4 AMR AF: 0.00109

Gnomad4 ASJ AF: 0.000313

Gnomad4 EAS AF: 0.000203

Gnomad4 SAS AF: 0.000432

Gnomad4 FIN AF: 0.000100

Gnomad4 NFE AF: 0.00191

Gnomad4 OTH AF: 0.00100

ClinVar

Significance: Benign

Submissions summary: Benign:2

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:2

Oct 01, 2022

CeGaT Center for Human Genetics Tuebingen

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

TBP: BS1, BS2 -

-

Department of Pathology and Laboratory Medicine, Sinai Health System

Significance: Likely benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

The TBP p.Gln87_Gln95del variant was not identified in the literature nor was it identified in dbSNP, ClinVar, Cosmic or LOVD 3.0. The variant was also not identified in the following control databases: the 1000 Genomes Project, the NHLBI GO Exome Sequencing Project, the Exome Aggregation Consortium (August 8th 2016), or the Genome Aggregation Database (Feb 27, 2017). The variant occurs outside of the splicing consensus sequence and in silico or computational prediction software programs (SpliceSiteFinder, MaxEntScan, NNSPLICE, GeneSplicer) do not predict a difference in splicing. This variant is an in-frame deletion resulting in the removal of glutamine (Gln) residues from codons 87-95; the impact of this alteration on TBP protein function is not known. In summary, based on the above information the clinical significance of this variant cannot be determined with certainty at this time although we would lean towards a more benign role for this variant. This variant is classified as likely benign. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs752404282; hg19: chr6-170871046;