6-170561958-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
Variant summary
Our verdict is Likely benign. The variant received -3 ACMG points: 0P and 3B. BP3BP6_Moderate
The ENST00000392092.7(TBP):c.258_281delGCAGCAGCAGCAGCAGCAGCAGCA(p.Gln87_Gln94del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.000154 in 1,405,164 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. There is a variant allele frequency bias in the population database for this variant (GnomAd4), which may indicate mosaicism or somatic mutations in the reference population data. Variant has been reported in ClinVar as Benign (★).
Frequency
Consequence
ENST00000392092.7 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- spinocerebellar ataxia type 17Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Laboratory for Molecular Medicine, Orphanet, Ambry Genetics, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -3 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: ENST00000392092.7. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TBP | NM_003194.5 | MANE Select | c.258_281delGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln87_Gln94del | disruptive_inframe_deletion | Exon 3 of 8 | NP_003185.1 | ||
| TBP | NM_001172085.2 | c.198_221delGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln67_Gln74del | disruptive_inframe_deletion | Exon 2 of 7 | NP_001165556.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TBP | ENST00000392092.7 | TSL:1 MANE Select | c.258_281delGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln87_Gln94del | disruptive_inframe_deletion | Exon 3 of 8 | ENSP00000375942.2 | ||
| TBP | ENST00000230354.10 | TSL:1 | c.258_281delGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln87_Gln94del | disruptive_inframe_deletion | Exon 3 of 8 | ENSP00000230354.5 | ||
| TBP | ENST00000421512.5 | TSL:1 | c.258_281delGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln87_Gln94del | disruptive_inframe_deletion | Exon 3 of 5 | ENSP00000400008.1 |
Frequencies
GnomAD3 genomes AF: 0.000335 AC: 48AN: 143368Hom.: 0 Cov.: 21 show subpopulations
GnomAD4 exome AF: 0.000133 AC: 168AN: 1261690Hom.: 0 AF XY: 0.000127 AC XY: 80AN XY: 630690 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.000335 AC: 48AN: 143474Hom.: 0 Cov.: 21 AF XY: 0.000400 AC XY: 28AN XY: 70062 show subpopulations ⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.
Age Distribution
ClinVar
ClinVar submissions as Germline
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at