NM_003194.5:c.258_281delGCAGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chr6-170561958-ACAGCAGCAGCAGCAGCAGCAGCAG-A
• rs752404282
• NM_003194.5:c.258_281delGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. The variant received -3 ACMG points: 0P and 3B. BP3 BP6_Moderate

The NM_003194.5(TBP):​c.258_281delGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln87_Gln94del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.000154 in 1,405,164 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. There is a variant allele frequency bias in the population database for this variant (GnomAd4), which may indicate mosaicism or somatic mutations in the reference population data. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.00033 (0 hom., cov: 21)
  • Exomes 𝑓: 0.00013 (0 hom.)
• Consequence: TBP NM_003194.5 disruptive_inframe_deletion
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 5.03
• Publications: 4 publications found

Genes affected

TBP (HGNC:11588): (TATA-box binding protein) Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes TBP, the TATA-binding protein. A distinctive feature of TBP is a long string of glutamines in the N-terminus. This region of the protein modulates the DNA binding activity of the C terminus, and modulation of DNA binding affects the rate of transcription complex formation and initiation of transcription. The number of CAG repeats encoding the polyglutamine tract is usually 25-42, and expansion of the number of repeats to 45-66 increases the length of the polyglutamine string and is associated with spinocerebellar ataxia 17, a neurodegenerative disorder classified as a polyglutamine disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2016]

TBP Gene-Disease associations (from GenCC):

• spinocerebellar ataxia type 17

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Laboratory for Molecular Medicine, Orphanet, Ambry Genetics, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Likely_benign. The variant received -3 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_003194.5
• BP6: Variant 6-170561958-ACAGCAGCAGCAGCAGCAGCAGCAG-A is Benign according to our data. Variant chr6-170561958-ACAGCAGCAGCAGCAGCAGCAGCAG-A is described in ClinVar as Benign. ClinVar VariationId is 2657159.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_003194.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TBP	NM_003194.5	MANE Select	c.258_281delGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln87_Gln94del	disruptive_inframe_deletion	Exon 3 of 8	NP_003185.1
	TBP	NM_001172085.2		c.198_221delGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln67_Gln74del	disruptive_inframe_deletion	Exon 2 of 7	NP_001165556.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TBP	ENST00000392092.7	TSL:1 MANE Select	c.258_281delGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln87_Gln94del	disruptive_inframe_deletion	Exon 3 of 8	ENSP00000375942.2
	TBP	ENST00000230354.10	TSL:1	c.258_281delGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln87_Gln94del	disruptive_inframe_deletion	Exon 3 of 8	ENSP00000230354.5
	TBP	ENST00000421512.5	TSL:1	c.258_281delGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln87_Gln94del	disruptive_inframe_deletion	Exon 3 of 5	ENSP00000400008.1

Frequencies

GnomAD3 genomes AF: 0.000335 AC: 48 AN: 143368 Hom.: 0 Cov.: 21

Gnomad AFR AF: 0.000230

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00178

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000432

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000173

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.000133 AC: 168 AN: 1261690 Hom.: 0 AF XY: 0.000127 AC XY: 80 AN XY: 630690

African (AFR) AF: 0.000139 AC: 4 AN: 28776

American (AMR) AF: 0.000716 AC: 30 AN: 41892

Ashkenazi Jewish (ASJ) AF: 0.000126 AC: 3 AN: 23726

East Asian (EAS) AF: 0.0000521 AC: 2 AN: 38406

South Asian (SAS) AF: 0.0000122 AC: 1 AN: 81728

European-Finnish (FIN) AF: 0.0000215 AC: 1 AN: 46476

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4954

European-Non Finnish (NFE) AF: 0.000122 AC: 115 AN: 941834

Other (OTH) AF: 0.000223 AC: 12 AN: 53898

GnomAD4 genome AF: 0.000335 AC: 48 AN: 143474 Hom.: 0 Cov.: 21 AF XY: 0.000400 AC XY: 28 AN XY: 70062

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.000229 AC: 9 AN: 39244

American (AMR) AF: 0.00177 AC: 26 AN: 14658

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3200

East Asian (EAS) AF: 0.00 AC: 0 AN: 4916

South Asian (SAS) AF: 0.000432 AC: 2 AN: 4628

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 9992

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 268

European-Non Finnish (NFE) AF: 0.000173 AC: 11 AN: 63754

Other (OTH) AF: 0.00 AC: 0 AN: 1998

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0.0000000000000326406), which strongly suggests a high chance of mosaicism in these individuals.

Alfa AF: 0.00 Hom.: 4

ClinVar

ClinVar submissions as Germline

Significance: Benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	1	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.0
Mutation Taster		=147/53	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs752404282; hg19: chr6-170871046;