6-38722935-GGCAGAAGATGGTTTCTCTCCTTCC-GGCAGAAGATGGTTTCTCTCCTTCCGCAGAAGATGGTTTCTCTCCTTCC

Variant names:

• chr6-38722935-G-GGCAGAAGATGGTTTCTCTCCTTCC
• rs774952820
• NM_001206927.2:c.137_160dupGTTTCTCTCCTTCCGCAGAAGATG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_001206927.2(DNAH8):​c.137_160dupGTTTCTCTCCTTCCGCAGAAGATG​(p.Gly46_Asp53dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000577 in 1,612,534 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: 𝑓 0.000020 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000062 (0 hom.)
• Consequence: DNAH8 NM_001206927.2 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.29
• Publications: 0 publications found

Genes affected

DNAH8 (HGNC:2952): (dynein axonemal heavy chain 8) The protein encoded by this gene is a heavy chain of an axonemal dynein involved in sperm and respiratory cilia motility. Axonemal dyneins generate force through hydrolysis of ATP and binding to microtubules. [provided by RefSeq, Jan 2012]

DNAH8 Gene-Disease associations (from GenCC):

• spermatogenic failure 46

  Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen
• spermatogenic failure 5

  Inheritance: AR Classification: MODERATE Submitted by: Franklin by Genoox
• primary ciliary dyskinesia

  Inheritance: AR Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001206927.2.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
DNAH8	NM_001206927.2	c.137_160dupGTTTCTCTCCTTCCGCAGAAGATG	p.Gly46_Asp53dup	disruptive_inframe_insertion	Exon 2 of 93	ENST00000327475.11	NP_001193856.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
DNAH8	ENST00000327475.11	c.137_160dupGTTTCTCTCCTTCCGCAGAAGATG	p.Gly46_Asp53dup	disruptive_inframe_insertion	Exon 2 of 93	5	NM_001206927.2	ENSP00000333363.7
DNAH8	ENST00000373278.8	c.137_160dupGTTTCTCTCCTTCCGCAGAAGATG	p.Gly46_Asp53dup	disruptive_inframe_insertion	Exon 2 of 5	1		ENSP00000362375.4
DNAH8	ENST00000449981.6	c.137_160dupGTTTCTCTCCTTCCGCAGAAGATG	p.Gly46_Asp53dup	disruptive_inframe_insertion	Exon 1 of 82	5		ENSP00000415331.2
DNAH8	ENST00000359357.7	c.-441_-440insGCAGAAGATGGTTTCTCTCCTTCC		upstream_gene_variant		2		ENSP00000352312.3

Frequencies

GnomAD3 genomes AF: 0.0000197 AC: 3 AN: 152156 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000441

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000247 AC: 6 AN: 242566 AF XY: 0.0000225

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000291

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000461

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000616 AC: 90 AN: 1460378 Hom.: 0 Cov.: 32 AF XY: 0.0000592 AC XY: 43 AN XY: 726482

African (AFR) AF: 0.0000299 AC: 1 AN: 33472

American (AMR) AF: 0.0000224 AC: 1 AN: 44710

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26130

East Asian (EAS) AF: 0.00 AC: 0 AN: 39696

South Asian (SAS) AF: 0.00 AC: 0 AN: 86230

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52238

Middle Eastern (MID) AF: 0.000347 AC: 2 AN: 5766

European-Non Finnish (NFE) AF: 0.0000729 AC: 81 AN: 1111786

Other (OTH) AF: 0.0000828 AC: 5 AN: 60350

GnomAD4 genome AF: 0.0000197 AC: 3 AN: 152156 Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0 AN XY: 74318

African (AFR) AF: 0.00 AC: 0 AN: 41428

American (AMR) AF: 0.00 AC: 0 AN: 15274

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5194

South Asian (SAS) AF: 0.00 AC: 0 AN: 4828

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10616

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000441 AC: 3 AN: 68026

Other (OTH) AF: 0.00 AC: 0 AN: 2090

Alfa AF: 0.0000434 Hom.: 0

EpiCase AF: 0.000218

EpiControl AF: 0.00

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Primary ciliary dyskinesia Uncertain:1

Aug 27, 2021

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.3
Mutation Taster		=84/16	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs774952820; hg19: chr6-38690711;