rs774952820

Variant names:

• chr6-38722935-GGCAGAAGATGGTTTCTCTCCTTCC-G
• rs774952820
• NM_001206927.2:c.137_160delGTTTCTCTCCTTCCGCAGAAGATG

Your query was ambiguous. Multiple possible variants found:

• chr6-38722935-GGCAGAAGATGGTTTCTCTCCTTCC-G
• chr6-38722935-GGCAGAAGATGGTTTCTCTCCTTCC-GGCAGAAGATGGTTTCTCTCCTTCCGCAGAAGATGGTTTCTCTCCTTCC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The ENST00000327475.11(DNAH8):​c.137_160delGTTTCTCTCCTTCCGCAGAAGATG​(p.Gly46_Asp53del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000105 in 1,612,534 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000011 (0 hom.)
• Consequence: DNAH8 ENST00000327475.11 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.29
• Publications: 0 publications found

Genes affected

DNAH8 (HGNC:2952): (dynein axonemal heavy chain 8) The protein encoded by this gene is a heavy chain of an axonemal dynein involved in sperm and respiratory cilia motility. Axonemal dyneins generate force through hydrolysis of ATP and binding to microtubules. [provided by RefSeq, Jan 2012]

DNAH8 Gene-Disease associations (from GenCC):

• spermatogenic failure 46

  Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen
• spermatogenic failure 5

  Inheritance: AR Classification: MODERATE Submitted by: Franklin by Genoox
• primary ciliary dyskinesia

  Inheritance: AR Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in ENST00000327475.11.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000327475.11. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DNAH8	NM_001206927.2	MANE Select	c.137_160delGTTTCTCTCCTTCCGCAGAAGATG	p.Gly46_Asp53del	disruptive_inframe_deletion	Exon 2 of 93	NP_001193856.1
	DNAH8	NM_001371.4		c.-430_-407delGTTTCTCTCCTTCCGCAGAAGATG		5_prime_UTR	Exon 2 of 92	NP_001362.2

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DNAH8	ENST00000327475.11	TSL:5 MANE Select	c.137_160delGTTTCTCTCCTTCCGCAGAAGATG	p.Gly46_Asp53del	disruptive_inframe_deletion	Exon 2 of 93	ENSP00000333363.7
	DNAH8	ENST00000373278.8	TSL:1	c.137_160delGTTTCTCTCCTTCCGCAGAAGATG	p.Gly46_Asp53del	disruptive_inframe_deletion	Exon 2 of 5	ENSP00000362375.4
	DNAH8	ENST00000449981.6	TSL:5	c.137_160delGTTTCTCTCCTTCCGCAGAAGATG	p.Gly46_Asp53del	disruptive_inframe_deletion	Exon 1 of 82	ENSP00000415331.2

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152156 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.00000412 AC: 1 AN: 242566 AF XY: 0.00

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000921

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000110 AC: 16 AN: 1460378 Hom.: 0 AF XY: 0.00000964 AC XY: 7 AN XY: 726482

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33472

American (AMR) AF: 0.00 AC: 0 AN: 44710

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26130

East Asian (EAS) AF: 0.00 AC: 0 AN: 39696

South Asian (SAS) AF: 0.00 AC: 0 AN: 86230

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52238

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5766

European-Non Finnish (NFE) AF: 0.0000144 AC: 16 AN: 1111786

Other (OTH) AF: 0.00 AC: 0 AN: 60350

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.0000000000411111), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152156 Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0 AN XY: 74318

African (AFR) AF: 0.00 AC: 0 AN: 41428

American (AMR) AF: 0.00 AC: 0 AN: 15274

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5194

South Asian (SAS) AF: 0.00 AC: 0 AN: 4828

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10616

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000147 AC: 1 AN: 68026

Other (OTH) AF: 0.00 AC: 0 AN: 2090

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Primary ciliary dyskinesia (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.3
Mutation Taster		=174/26	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs774952820; hg19: chr6-38690711;