6-45422693-ACAGCAGCAGCAGCAACAGCAG-ACAGCAGCAGCAGCAACAGCAGCAGCAGCAGCAGCAACAGCAG

Variant names:

• chr6-45422693-A-ACAGCAGCAGCAGCAACAGCAG
• rs774172072
• NM_001024630.4:c.193_213dupCAACAGCAGCAGCAGCAGCAG

Variant summary

Our verdict is Likely benign. Variant got -6 ACMG points: 0P and 6B. BP3 BS1_Supporting BS2

The NM_001024630.4(RUNX2):​c.193_213dupCAACAGCAGCAGCAGCAGCAG​(p.Gln65_Gln71dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000259 in 1,601,396 control chromosomes in the GnomAD database, including 2 homozygotes. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: 𝑓 0.00042 (0 hom., cov: 30)
  • Exomes 𝑓: 0.00024 (2 hom.)
• Consequence: RUNX2 NM_001024630.4 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.62

Genes affected

RUNX2 (HGNC:10472): (RUNX family transcription factor 2) This gene is a member of the RUNX family of transcription factors and encodes a nuclear protein with an Runt DNA-binding domain. This protein is essential for osteoblastic differentiation and skeletal morphogenesis and acts as a scaffold for nucleic acids and regulatory factors involved in skeletal gene expression. The protein can bind DNA both as a monomer or, with more affinity, as a subunit of a heterodimeric complex. Two regions of potential trinucleotide repeat expansions are present in the N-terminal region of the encoded protein, and these and other mutations in this gene have been associated with the bone development disorder cleidocranial dysplasia (CCD). Transcript variants that encode different protein isoforms result from the use of alternate promoters as well as alternate splicing. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Likely_benign. Variant got -6 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001024630.4
• BS1: Variant frequency is greater than expected in population amr. gnomad4 allele frequency = 0.000415 (63/151662) while in subpopulation AMR AF= 0.00118 (18/15230). AF 95% confidence interval is 0.000764. There are 0 homozygotes in gnomad4. There are 34 alleles in male gnomad4 subpopulation. Median coverage is 30. This position pass quality control queck. Existence of Clinvar submissions makes me limit the strength of this signal to Supporting
• BS2: High AC in GnomAd4 at 63 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RUNX2	NM_001024630.4	c.193_213dupCAACAGCAGCAGCAGCAGCAG	p.Gln65_Gln71dup	conservative_inframe_insertion	Exon 3 of 9	ENST00000647337.2	NP_001019801.3
RUNX2	NM_001369405.1	c.151_171dupCAACAGCAGCAGCAGCAGCAG	p.Gln51_Gln57dup	conservative_inframe_insertion	Exon 1 of 7		NP_001356334.1
RUNX2	NM_001015051.4	c.193_213dupCAACAGCAGCAGCAGCAGCAG	p.Gln65_Gln71dup	conservative_inframe_insertion	Exon 3 of 8		NP_001015051.3
RUNX2	NM_001278478.2	c.151_171dupCAACAGCAGCAGCAGCAGCAG	p.Gln51_Gln57dup	conservative_inframe_insertion	Exon 1 of 6		NP_001265407.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RUNX2	ENST00000647337.2	c.193_213dupCAACAGCAGCAGCAGCAGCAG	p.Gln65_Gln71dup	conservative_inframe_insertion	Exon 3 of 9		NM_001024630.4	ENSP00000495497.1

Frequencies

GnomAD3 genomes AF: 0.000409 AC: 62 AN: 151558 Hom.: 0 Cov.: 30

Gnomad AFR AF: 0.000242

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00118

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000195

Gnomad SAS AF: 0.000209

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000383

Gnomad OTH AF: 0.00288

GnomAD3 exomes AF: 0.000138 AC: 32 AN: 232308 Hom.: 0 AF XY: 0.0000937 AC XY: 12 AN XY: 128068

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.000715

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.0000604

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.0000471

Gnomad NFE exome AF: 0.0000569

Gnomad OTH exome AF: 0.000181

GnomAD4 exome AF: 0.000242 AC: 351 AN: 1449734 Hom.: 2 Cov.: 34 AF XY: 0.000233 AC XY: 168 AN XY: 720994

Gnomad4 AFR exome AF: 0.000153

Gnomad4 AMR exome AF: 0.000899

Gnomad4 ASJ exome AF: 0.0000386

Gnomad4 EAS exome AF: 0.000285

Gnomad4 SAS exome AF: 0.000178

Gnomad4 FIN exome AF: 0.0000192

Gnomad4 NFE exome AF: 0.000222

Gnomad4 OTH exome AF: 0.000534

GnomAD4 genome AF: 0.000415 AC: 63 AN: 151662 Hom.: 0 Cov.: 30 AF XY: 0.000459 AC XY: 34 AN XY: 74126

Gnomad4 AFR AF: 0.000241

Gnomad4 AMR AF: 0.00118

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.000196

Gnomad4 SAS AF: 0.000209

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000383

Gnomad4 OTH AF: 0.00333

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Jan 20, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.193_213dup, results in the insertion of 7 amino acid(s) of the RUNX2 protein (p.Gln65_Gln71dup), but otherwise preserves the integrity of the reading frame. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the gnomAD database. This variant has not been reported in the literature in individuals affected with RUNX2-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs774172072; hg19: chr6-45390430;