rs774172072

Variant names:

• chr6-45422693-ACAGCAGCAGCAGCAACAGCAG-A
• rs774172072
• NM_001024630.4:c.193_213delCAACAGCAGCAGCAGCAGCAG

Your query was ambiguous. Multiple possible variants found:

• chr6-45422693-ACAGCAGCAGCAGCAACAGCAG-A
• chr6-45422693-ACAGCAGCAGCAGCAACAGCAG-ACAGCAGCAGCAGCAACAGCAGCAGCAGCAGCAGCAACAGCAG

Variant summary

Our verdict is Benign. Variant got -10 ACMG points: 0P and 10B. BP3 BP6 BS1 BS2

The NM_001024630.4(RUNX2):​c.193_213delCAACAGCAGCAGCAGCAGCAG​(p.Gln65_Gln71del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0014 in 1,601,344 control chromosomes in the GnomAD database, including 2 homozygotes. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.0016 (0 hom., cov: 30)
  • Exomes 𝑓: 0.0014 (2 hom.)
• Consequence: RUNX2 NM_001024630.4 conservative_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:2 B:4
• Conservation: PhyloP100: 3.50

Genes affected

RUNX2 (HGNC:10472): (RUNX family transcription factor 2) This gene is a member of the RUNX family of transcription factors and encodes a nuclear protein with an Runt DNA-binding domain. This protein is essential for osteoblastic differentiation and skeletal morphogenesis and acts as a scaffold for nucleic acids and regulatory factors involved in skeletal gene expression. The protein can bind DNA both as a monomer or, with more affinity, as a subunit of a heterodimeric complex. Two regions of potential trinucleotide repeat expansions are present in the N-terminal region of the encoded protein, and these and other mutations in this gene have been associated with the bone development disorder cleidocranial dysplasia (CCD). Transcript variants that encode different protein isoforms result from the use of alternate promoters as well as alternate splicing. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Benign. Variant got -10 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001024630.4
• BP6: Variant 6-45422693-ACAGCAGCAGCAGCAACAGCAG-A is Benign according to our data. Variant chr6-45422693-ACAGCAGCAGCAGCAACAGCAG-A is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 196302.We mark this variant Likely_benign, oryginal submissions are: {Likely_benign=4, Uncertain_significance=2}.
• BS1: Variant frequency is greater than expected in population nfe. gnomad4 allele frequency = 0.00156 (237/151656) while in subpopulation NFE AF= 0.00255 (173/67814). AF 95% confidence interval is 0.00224. There are 0 homozygotes in gnomad4. There are 99 alleles in male gnomad4 subpopulation. Median coverage is 30. This position pass quality control queck.
• BS2: High AC in GnomAd4 at 237 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RUNX2	NM_001024630.4	c.193_213delCAACAGCAGCAGCAGCAGCAG	p.Gln65_Gln71del	conservative_inframe_deletion	Exon 3 of 9	ENST00000647337.2	NP_001019801.3
RUNX2	NM_001369405.1	c.151_171delCAACAGCAGCAGCAGCAGCAG	p.Gln51_Gln57del	conservative_inframe_deletion	Exon 1 of 7		NP_001356334.1
RUNX2	NM_001015051.4	c.193_213delCAACAGCAGCAGCAGCAGCAG	p.Gln65_Gln71del	conservative_inframe_deletion	Exon 3 of 8		NP_001015051.3
RUNX2	NM_001278478.2	c.151_171delCAACAGCAGCAGCAGCAGCAG	p.Gln51_Gln57del	conservative_inframe_deletion	Exon 1 of 6		NP_001265407.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RUNX2	ENST00000647337.2	c.193_213delCAACAGCAGCAGCAGCAGCAG	p.Gln65_Gln71del	conservative_inframe_deletion	Exon 3 of 9		NM_001024630.4	ENSP00000495497.1

Frequencies

GnomAD3 genomes AF: 0.00156 AC: 237 AN: 151552 Hom.: 0 Cov.: 30

Gnomad AFR AF: 0.000993

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000657

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000390

Gnomad SAS AF: 0.000417

Gnomad FIN AF: 0.000665

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00255

Gnomad OTH AF: 0.000961

GnomAD3 exomes AF: 0.00104 AC: 242 AN: 232308 Hom.: 1 AF XY: 0.00108 AC XY: 138 AN XY: 128068

Gnomad AFR exome AF: 0.000232

Gnomad AMR exome AF: 0.000684

Gnomad ASJ exome AF: 0.000104

Gnomad EAS exome AF: 0.000664

Gnomad SAS exome AF: 0.000347

Gnomad FIN exome AF: 0.000659

Gnomad NFE exome AF: 0.00170

Gnomad OTH exome AF: 0.000361

GnomAD4 exome AF: 0.00139 AC: 2011 AN: 1449688 Hom.: 2 AF XY: 0.00144 AC XY: 1040 AN XY: 720976

Gnomad4 AFR exome AF: 0.000552

Gnomad4 AMR exome AF: 0.000669

Gnomad4 ASJ exome AF: 0.000116

Gnomad4 EAS exome AF: 0.000856

Gnomad4 SAS exome AF: 0.000403

Gnomad4 FIN exome AF: 0.00150

Gnomad4 NFE exome AF: 0.00155

Gnomad4 OTH exome AF: 0.00165

GnomAD4 genome AF: 0.00156 AC: 237 AN: 151656 Hom.: 0 Cov.: 30 AF XY: 0.00134 AC XY: 99 AN XY: 74122

Gnomad4 AFR AF: 0.000990

Gnomad4 AMR AF: 0.000657

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.000391

Gnomad4 SAS AF: 0.000418

Gnomad4 FIN AF: 0.000665

Gnomad4 NFE AF: 0.00255

Gnomad4 OTH AF: 0.000951

Alfa AF: 0.00129 Hom.: 0

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Uncertain:2 Benign:4

Revision: criteria provided, conflicting classifications

Submissions by phenotype

not provided Uncertain:2 Benign:3

Apr 01, 2021

GeneDx

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In-frame deletion in a repetitive region with no known function; Has not been previously published as pathogenic or benign to our knowledge -

Jan 05, 2015

Eurofins Ntd Llc (ga)

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Mar 22, 2024

ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Mar 01, 2023

CeGaT Center for Human Genetics Tuebingen

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

RUNX2: BS1 -

Jan 29, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.193_213del, results in the deletion of 7 amino acid(s) of the RUNX2 protein (p.Gln65_Gln71del), but otherwise preserves the integrity of the reading frame. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the gnomAD database. This variant has not been reported in the literature in individuals affected with RUNX2-related conditions. ClinVar contains an entry for this variant (Variation ID: 196302). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

not specified Benign:1

Jun 06, 2017

Genetic Services Laboratory, University of Chicago

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs774172072; hg19: chr6-45390430;