6-81752010-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCG-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCG
Variant summary
Our verdict is Benign. Variant got -14 ACMG points: 2P and 16B. PM4BP6_Very_StrongBA1
The NM_017633.3(TENT5A):c.131_132insCGGCGACTTCGGCGGCGGCGACTTCGGCGG(p.Asp36_Gly45dup) variant causes a inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0267 in 1,200,868 control chromosomes in the GnomAD database, including 1,386 homozygotes. Variant has been reported in ClinVar as Likely benign (★★). Synonymous variant affecting the same amino acid position (i.e. G44G) has been classified as Benign.
Frequency
Consequence
NM_017633.3 inframe_insertion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Benign. Variant got -14 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | UniProt |
---|---|---|---|---|---|---|---|
TENT5A | NM_017633.3 | c.131_132insCGGCGACTTCGGCGGCGGCGACTTCGGCGG | p.Asp36_Gly45dup | inframe_insertion | 2/3 | ENST00000320172.11 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|
TENT5A | ENST00000320172.11 | c.131_132insCGGCGACTTCGGCGGCGGCGACTTCGGCGG | p.Asp36_Gly45dup | inframe_insertion | 2/3 | 1 | NM_017633.3 | A2 | |
TENT5A | ENST00000369754.7 | c.188_189insCGGCGACTTCGGCGGCGGCGACTTCGGCGG | p.Asp55_Gly64dup | inframe_insertion | 2/3 | 1 | P4 | ||
TENT5A | ENST00000369756.3 | c.374_375insCGGCGACTTCGGCGGCGGCGACTTCGGCGG | p.Asp117_Gly126dup | inframe_insertion | 2/3 | 1 |
Frequencies
GnomAD3 genomes AF: 0.0748 AC: 10445AN: 139558Hom.: 755 Cov.: 0
GnomAD4 exome AF: 0.0267 AC: 32116AN: 1200868Hom.: 1386 Cov.: 34 AF XY: 0.0283 AC XY: 17046AN XY: 603070
GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.0748 AC: 10451AN: 139636Hom.: 754 Cov.: 0 AF XY: 0.0748 AC XY: 5061AN XY: 67686
ClinVar
Submissions by phenotype
not provided Benign:2
Likely benign, criteria provided, single submitter | clinical testing | Invitae | Jan 31, 2024 | - - |
Benign, criteria provided, single submitter | clinical testing | GeneDx | Aug 26, 2019 | - - |
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at