6-81752010-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCG-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCG

Variant names:

• chr6-81752010-A-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCG
• rs754008809
• NM_017633.3:c.102_131dupCGGCGACTTCGGCGGCGGCGACTTCGGCGG

Variant summary

Our verdict is Benign. The variant received -14 ACMG points: 2P and 16B. PM4 BP6_Very_Strong BA1

The NM_017633.3(TENT5A):​c.102_131dupCGGCGACTTCGGCGGCGGCGACTTCGGCGG​(p.Gly44_Gly45insGlyAspPheGlyGlyGlyAspPheGlyGly) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0267 in 1,200,868 control chromosomes in the GnomAD database, including 1,386 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★). Synonymous variant affecting the same amino acid position (i.e. G44G) has been classified as Benign.

• Frequency:
  • Genomes: 𝑓 0.075 (754 hom., cov: 0)
  • Exomes 𝑓: 0.027 (1386 hom.)
  • Failed GnomAD Quality Control
• Consequence: TENT5A NM_017633.3 disruptive_inframe_insertion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:3
• Conservation: PhyloP100: 0.0420
• Publications: 6 publications found

Genes affected

TENT5A (HGNC:18345): (terminal nucleotidyltransferase 5A) Enables RNA binding activity. Predicted to be involved in mRNA stabilization. Predicted to act upstream of or within response to bacterium. Implicated in lung non-small cell carcinoma; osteoarthritis; and osteogenesis imperfecta type 18. [provided by Alliance of Genome Resources, Apr 2022]

TENT5A Gene-Disease associations (from GenCC):

• osteogenesis imperfecta, type 18

  Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• osteogenesis imperfecta

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -14 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_017633.3.
• BP6: Variant 6-81752010-A-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCG is Benign according to our data. Variant chr6-81752010-A-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCG is described in ClinVar as Benign/Likely_benign. ClinVar VariationId is 1250446.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BA1: GnomAdExome4 highest subpopulation (SAS) allele frequency at 95% confidence interval = 0.0572 is higher than 0.05.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_017633.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TENT5A	NM_017633.3	MANE Select	c.102_131dupCGGCGACTTCGGCGGCGGCGACTTCGGCGG	p.Gly44_Gly45insGlyAspPheGlyGlyGlyAspPheGlyGly	disruptive_inframe_insertion	Exon 2 of 3	NP_060103.2	Q96IP4-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TENT5A	ENST00000320172.11	TSL:1 MANE Select	c.102_131dupCGGCGACTTCGGCGGCGGCGACTTCGGCGG	p.Gly44_Gly45insGlyAspPheGlyGlyGlyAspPheGlyGly	disruptive_inframe_insertion	Exon 2 of 3	ENSP00000318298.6	Q96IP4-1
	TENT5A	ENST00000369756.3	TSL:1	c.345_374dupCGGCGACTTCGGCGGCGGCGACTTCGGCGG	p.Gly125_Gly126insGlyAspPheGlyGlyGlyAspPheGlyGly	disruptive_inframe_insertion	Exon 2 of 3	ENSP00000358771.3	Q5TF85
	TENT5A	ENST00000369754.7	TSL:1	c.159_188dupCGGCGACTTCGGCGGCGGCGACTTCGGCGG	p.Gly63_Gly64insGlyAspPheGlyGlyGlyAspPheGlyGly	disruptive_inframe_insertion	Exon 2 of 3	ENSP00000358769.3	Q96IP4-2

Frequencies

GnomAD3 genomes AF: 0.0748 AC: 10445 AN: 139558 Hom.: 755 Cov.: 0

Gnomad AFR AF: 0.0997

Gnomad AMI AF: 0.0535

Gnomad AMR AF: 0.0851

Gnomad ASJ AF: 0.0571

Gnomad EAS AF: 0.0654

Gnomad SAS AF: 0.0783

Gnomad FIN AF: 0.0528

Gnomad MID AF: 0.0764

Gnomad NFE AF: 0.0637

Gnomad OTH AF: 0.0625

GnomAD4 exome AF: 0.0267 AC: 32116 AN: 1200868 Hom.: 1386 Cov.: 34 AF XY: 0.0283 AC XY: 17046 AN XY: 603070

African (AFR) AF: 0.0443 AC: 1121 AN: 25314

American (AMR) AF: 0.0469 AC: 1734 AN: 36992

Ashkenazi Jewish (ASJ) AF: 0.0367 AC: 840 AN: 22892

East Asian (EAS) AF: 0.0485 AC: 1831 AN: 37742

South Asian (SAS) AF: 0.0586 AC: 4356 AN: 74298

European-Finnish (FIN) AF: 0.0548 AC: 2355 AN: 42968

Middle Eastern (MID) AF: 0.0268 AC: 110 AN: 4100

European-Non Finnish (NFE) AF: 0.0197 AC: 17870 AN: 905230

Other (OTH) AF: 0.0370 AC: 1899 AN: 51332

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.0748 AC: 10451 AN: 139636 Hom.: 754 Cov.: 0 AF XY: 0.0748 AC XY: 5061 AN XY: 67686

African (AFR) AF: 0.0999 AC: 3652 AN: 36574

American (AMR) AF: 0.0849 AC: 1211 AN: 14258

Ashkenazi Jewish (ASJ) AF: 0.0571 AC: 191 AN: 3344

East Asian (EAS) AF: 0.0656 AC: 298 AN: 4542

South Asian (SAS) AF: 0.0774 AC: 323 AN: 4174

European-Finnish (FIN) AF: 0.0528 AC: 502 AN: 9512

Middle Eastern (MID) AF: 0.0746 AC: 20 AN: 268

European-Non Finnish (NFE) AF: 0.0637 AC: 4089 AN: 64150

Other (OTH) AF: 0.0610 AC: 118 AN: 1936

Alfa AF: 0.0228 Hom.: 1118

ClinVar

ClinVar submissions

Significance: Benign/Likely benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	2	not provided (2)
-	-	1	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.042
Mutation Taster		=83/17	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs754008809; hg19: chr6-82461727;