6-81752010-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCG-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCG

Variant names:

• chr6-81752010-A-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCG
• rs754008809
• NM_017633.3:c.87_131dupCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG

Variant summary

Our verdict is Benign. The variant received -10 ACMG points: 2P and 12B. PM4 BP6_Very_Strong BS2

The NM_017633.3(TENT5A):​c.87_131dupCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG​(p.Gly44_Gly45insGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGly) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★★). Synonymous variant affecting the same amino acid position (i.e. G44G) has been classified as Benign.

• Frequency:
  • Genomes: 𝑓 0.0075 (42 hom., cov: 0)
  • Exomes 𝑓: 0.0037 (43 hom.)
  • Failed GnomAD Quality Control
• Consequence: TENT5A NM_017633.3 disruptive_inframe_insertion
• Clinical Significance: Benign criteria provided, multiple submitters, no conflicts B:2
• Conservation: PhyloP100: 0.0420
• Publications: 6 publications found

Genes affected

TENT5A (HGNC:18345): (terminal nucleotidyltransferase 5A) Enables RNA binding activity. Predicted to be involved in mRNA stabilization. Predicted to act upstream of or within response to bacterium. Implicated in lung non-small cell carcinoma; osteoarthritis; and osteogenesis imperfecta type 18. [provided by Alliance of Genome Resources, Apr 2022]

TENT5A Gene-Disease associations (from GenCC):

• osteogenesis imperfecta, type 18

  Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• osteogenesis imperfecta

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -10 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_017633.3.
• BP6: Variant 6-81752010-A-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCG is Benign according to our data. Variant chr6-81752010-A-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCG is described in ClinVar as Benign. ClinVar VariationId is 1164377.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS2: High Homozygotes in GnomAd4 at 42 AD,AR gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_017633.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TENT5A	NM_017633.3	MANE Select	c.87_131dupCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG	p.Gly44_Gly45insGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGly	disruptive_inframe_insertion	Exon 2 of 3	NP_060103.2

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TENT5A	ENST00000320172.11	TSL:1 MANE Select	c.87_131dupCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG	p.Gly44_Gly45insGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGly	disruptive_inframe_insertion	Exon 2 of 3	ENSP00000318298.6
	TENT5A	ENST00000369756.3	TSL:1	c.330_374dupCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG	p.Gly125_Gly126insGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGly	disruptive_inframe_insertion	Exon 2 of 3	ENSP00000358771.3
	TENT5A	ENST00000369754.7	TSL:1	c.144_188dupCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG	p.Gly63_Gly64insGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGly	disruptive_inframe_insertion	Exon 2 of 3	ENSP00000358769.3

Frequencies

GnomAD3 genomes AF: 0.00751 AC: 1049 AN: 139628 Hom.: 42 Cov.: 0

Gnomad AFR AF: 0.00583

Gnomad AMI AF: 0.00797

Gnomad AMR AF: 0.00540

Gnomad ASJ AF: 0.00120

Gnomad EAS AF: 0.00197

Gnomad SAS AF: 0.00526

Gnomad FIN AF: 0.00368

Gnomad MID AF: 0.00347

Gnomad NFE AF: 0.0105

Gnomad OTH AF: 0.00416

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00368 AC: 4422 AN: 1201694 Hom.: 43 Cov.: 34 AF XY: 0.00382 AC XY: 2303 AN XY: 603446

African (AFR) AF: 0.00303 AC: 77 AN: 25446

American (AMR) AF: 0.00258 AC: 96 AN: 37188

Ashkenazi Jewish (ASJ) AF: 0.00183 AC: 42 AN: 22938

East Asian (EAS) AF: 0.00267 AC: 101 AN: 37822

South Asian (SAS) AF: 0.00398 AC: 296 AN: 74420

European-Finnish (FIN) AF: 0.00519 AC: 223 AN: 42962

Middle Eastern (MID) AF: 0.00244 AC: 10 AN: 4102

European-Non Finnish (NFE) AF: 0.00371 AC: 3356 AN: 905432

Other (OTH) AF: 0.00430 AC: 221 AN: 51384

GnomAD4 genome AF: 0.00752 AC: 1050 AN: 139706 Hom.: 42 Cov.: 0 AF XY: 0.00697 AC XY: 472 AN XY: 67716

African (AFR) AF: 0.00585 AC: 214 AN: 36606

American (AMR) AF: 0.00540 AC: 77 AN: 14270

Ashkenazi Jewish (ASJ) AF: 0.00120 AC: 4 AN: 3342

East Asian (EAS) AF: 0.00198 AC: 9 AN: 4546

South Asian (SAS) AF: 0.00527 AC: 22 AN: 4178

European-Finnish (FIN) AF: 0.00368 AC: 35 AN: 9516

Middle Eastern (MID) AF: 0.00373 AC: 1 AN: 268

European-Non Finnish (NFE) AF: 0.0105 AC: 673 AN: 64164

Other (OTH) AF: 0.00413 AC: 8 AN: 1938

Alfa AF: 0.00152 Hom.: 1118

ClinVar

ClinVar submissions as Germline

Significance: Benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	1	not provided (1)
-	-	1	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.042
Mutation Taster		=83/17	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs754008809; hg19: chr6-82461727;