6-81752010-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCG-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCG

Position:

• chr6-81752010-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCG-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCG

Variant summary

Our verdict is Benign. Variant got -10 ACMG points: 2P and 12B. PM4 BP6_Very_Strong BS2

The NM_017633.3(TENT5A):​c.87_131dupCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG​(p.Gly44_Gly45insGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGly) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as Benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0075 (42 hom., cov: 0)
  • Exomes 𝑓: 0.0037 (43 hom.)
  • Failed GnomAD Quality Control
• Consequence: TENT5A NM_017633.3 disruptive_inframe_insertion
• Clinical Significance: Benign criteria provided, multiple submitters, no conflicts B:2
• Conservation: PhyloP100: 0.0420

Genes affected

TENT5A (HGNC:18345): (terminal nucleotidyltransferase 5A) Enables RNA binding activity. Predicted to be involved in mRNA stabilization. Predicted to act upstream of or within response to bacterium. Implicated in lung non-small cell carcinoma; osteoarthritis; and osteogenesis imperfecta type 18. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Verdict is Benign. Variant got -10 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_017633.3.
• BP6: Variant 6-81752010-A-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCG is Benign according to our data. Variant chr6-81752010-A-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCG is described in ClinVar as [Benign]. Clinvar id is 1164377.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS2: High Homozygotes in GnomAd4 at 42 AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
TENT5A	NM_017633.3	c.87_131dupCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG	p.Gly44_Gly45insGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGly	disruptive_inframe_insertion	2/3	ENST00000320172.11	NP_060103.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
TENT5A	ENST00000320172.11	c.87_131dupCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG	p.Gly44_Gly45insGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGly	disruptive_inframe_insertion	2/3	1	NM_017633.3	ENSP00000318298.6
TENT5A	ENST00000369756.3	c.330_374dupCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG	p.Gly125_Gly126insGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGly	disruptive_inframe_insertion	2/3	1		ENSP00000358771.3
TENT5A	ENST00000369754.7	c.144_188dupCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG	p.Gly63_Gly64insGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGly	disruptive_inframe_insertion	2/3	1		ENSP00000358769.3

Frequencies

GnomAD3 genomes AF: 0.00751 AC: 1049 AN: 139628 Hom.: 42 Cov.: 0

Gnomad AFR AF: 0.00583

Gnomad AMI AF: 0.00797

Gnomad AMR AF: 0.00540

Gnomad ASJ AF: 0.00120

Gnomad EAS AF: 0.00197

Gnomad SAS AF: 0.00526

Gnomad FIN AF: 0.00368

Gnomad MID AF: 0.00347

Gnomad NFE AF: 0.0105

Gnomad OTH AF: 0.00416

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00368 AC: 4422 AN: 1201694 Hom.: 43 Cov.: 34 AF XY: 0.00382 AC XY: 2303 AN XY: 603446

Gnomad4 AFR exome AF: 0.00303

Gnomad4 AMR exome AF: 0.00258

Gnomad4 ASJ exome AF: 0.00183

Gnomad4 EAS exome AF: 0.00267

Gnomad4 SAS exome AF: 0.00398

Gnomad4 FIN exome AF: 0.00519

Gnomad4 NFE exome AF: 0.00371

Gnomad4 OTH exome AF: 0.00430

GnomAD4 genome AF: 0.00752 AC: 1050 AN: 139706 Hom.: 42 Cov.: 0 AF XY: 0.00697 AC XY: 472 AN XY: 67716

Gnomad4 AFR AF: 0.00585

Gnomad4 AMR AF: 0.00540

Gnomad4 ASJ AF: 0.00120

Gnomad4 EAS AF: 0.00198

Gnomad4 SAS AF: 0.00527

Gnomad4 FIN AF: 0.00368

Gnomad4 NFE AF: 0.0105

Gnomad4 OTH AF: 0.00413

ClinVar

Significance: Benign

Submissions summary: Benign:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Benign:1

Benign, criteria provided, single submitter

clinical testing

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Oct 18, 2023

Variant summary: TENT5A c.87_131dup45 (p.Asp31_Gly45dup) results in an in-frame duplication that is predicted to duplicate 15 amino acids into the encoded protein. The variant allele was found at a frequency of 0.0075 in 139628 control chromosomes, predominantly at a frequency of 0.01 within the Non-Finnish European subpopulation in the gnomAD 3.0 database, including 24 homozygotes. To the best of our knowledge, c.87_131dup45 has been not reported in the literature in individuals affected with Osteogenesis Imperfecta, Type 18. A case-control study of tuberculosis reported this variant insignificantly distributed in both case and control cohorts (Etokebe_TENT5A_PLosOne_2014). To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. The following publication have been ascertained in the context of this evaluation (PMID: 24625963). One submitter has cited clinical-significance assessments for this variant to ClinVar after 2014 and has classified the variant as benign. Based on the evidence outlined above, the variant was classified as benign. -

not provided Benign:1

Benign, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Jan 29, 2024

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs754008809; hg19: chr6-82461727;