NM_017633.3:c.87_131dupCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG
Variant summary
Our verdict is Benign. The variant received -10 ACMG points: 2P and 12B. PM4BP6_Very_StrongBS2
The NM_017633.3(TENT5A):c.87_131dupCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG(p.Gly44_Gly45insGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGly) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★★). Synonymous variant affecting the same amino acid position (i.e. G44G) has been classified as Benign.
Frequency
Consequence
NM_017633.3 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- osteogenesis imperfecta, type 18Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- osteogenesis imperfectaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_017633.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TENT5A | NM_017633.3 | MANE Select | c.87_131dupCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG | p.Gly44_Gly45insGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGly | disruptive_inframe_insertion | Exon 2 of 3 | NP_060103.2 | Q96IP4-1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TENT5A | ENST00000320172.11 | TSL:1 MANE Select | c.87_131dupCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG | p.Gly44_Gly45insGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGly | disruptive_inframe_insertion | Exon 2 of 3 | ENSP00000318298.6 | Q96IP4-1 | |
| TENT5A | ENST00000369756.3 | TSL:1 | c.330_374dupCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG | p.Gly125_Gly126insGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGly | disruptive_inframe_insertion | Exon 2 of 3 | ENSP00000358771.3 | Q5TF85 | |
| TENT5A | ENST00000369754.7 | TSL:1 | c.144_188dupCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG | p.Gly63_Gly64insGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGly | disruptive_inframe_insertion | Exon 2 of 3 | ENSP00000358769.3 | Q96IP4-2 |
Frequencies
GnomAD3 genomes AF: 0.00751 AC: 1049AN: 139628Hom.: 42 Cov.: 0 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00368 AC: 4422AN: 1201694Hom.: 43 Cov.: 34 AF XY: 0.00382 AC XY: 2303AN XY: 603446 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.00752 AC: 1050AN: 139706Hom.: 42 Cov.: 0 AF XY: 0.00697 AC XY: 472AN XY: 67716 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at