6-81752010-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCG-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCG
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The ENST00000320172.11(TENT5A):c.72_131dupCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG(p.Gly44_Gly45insGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGly) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. G44G) has been classified as Benign.
Frequency
Consequence
ENST00000320172.11 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- osteogenesis imperfecta, type 18Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- osteogenesis imperfectaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: ENST00000320172.11. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TENT5A | NM_017633.3 | MANE Select | c.72_131dupCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG | p.Gly44_Gly45insGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGly | disruptive_inframe_insertion | Exon 2 of 3 | NP_060103.2 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TENT5A | ENST00000320172.11 | TSL:1 MANE Select | c.72_131dupCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG | p.Gly44_Gly45insGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGly | disruptive_inframe_insertion | Exon 2 of 3 | ENSP00000318298.6 | ||
| TENT5A | ENST00000369756.3 | TSL:1 | c.315_374dupCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG | p.Gly125_Gly126insGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGly | disruptive_inframe_insertion | Exon 2 of 3 | ENSP00000358771.3 | ||
| TENT5A | ENST00000369754.7 | TSL:1 | c.129_188dupCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG | p.Gly63_Gly64insGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGly | disruptive_inframe_insertion | Exon 2 of 3 | ENSP00000358769.3 |
Frequencies
GnomAD3 genomes AF: 0.000215 AC: 30AN: 139636Hom.: 1 Cov.: 0 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000932 AC: 112AN: 1201944Hom.: 0 Cov.: 34 AF XY: 0.0000828 AC XY: 50AN XY: 603562 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.000222 AC: 31AN: 139714Hom.: 1 Cov.: 0 AF XY: 0.000162 AC XY: 11AN XY: 67722 show subpopulations
Age Distribution
ClinVar
ClinVar submissions as Germline
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at