chr6-81752010-A-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCG
Variant summary
Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM4
The NM_017633.3(TENT5A):c.72_131dupCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG(p.Gly44_Gly45insGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGly) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_017633.3 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 2 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
TENT5A | NM_017633.3 | c.72_131dupCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG | p.Gly44_Gly45insGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGly | disruptive_inframe_insertion | Exon 2 of 3 | ENST00000320172.11 | NP_060103.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
TENT5A | ENST00000320172.11 | c.72_131dupCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG | p.Gly44_Gly45insGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGly | disruptive_inframe_insertion | Exon 2 of 3 | 1 | NM_017633.3 | ENSP00000318298.6 | ||
TENT5A | ENST00000369756.3 | c.315_374dupCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG | p.Gly125_Gly126insGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGly | disruptive_inframe_insertion | Exon 2 of 3 | 1 | ENSP00000358771.3 | |||
TENT5A | ENST00000369754.7 | c.129_188dupCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG | p.Gly63_Gly64insGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGly | disruptive_inframe_insertion | Exon 2 of 3 | 1 | ENSP00000358769.3 | |||
TENT5A | ENST00000412306.1 | c.-259_-200dupCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG | upstream_gene_variant | 3 | ENSP00000401884.1 |
Frequencies
GnomAD3 genomes AF: 0.000215 AC: 30AN: 139636Hom.: 1 Cov.: 0
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000932 AC: 112AN: 1201944Hom.: 0 Cov.: 34 AF XY: 0.0000828 AC XY: 50AN XY: 603562
GnomAD4 genome AF: 0.000222 AC: 31AN: 139714Hom.: 1 Cov.: 0 AF XY: 0.000162 AC XY: 11AN XY: 67722
ClinVar
Submissions by phenotype
not provided Uncertain:1
This variant, c.72_131dup, results in the insertion of 20 amino acid(s) of the FAM46A protein (p.Asp26_Gly45dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with clinical features of osteogenesis imperfecta (internal data). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
TENT5A-related disorder Uncertain:1
The TENT5A c.72_131dup60 variant is predicted to result in an in-frame duplication (p.Asp26_Gly45dup). To our knowledge, this variant has not been reported in the literature or in a large population database (http://gnomad.broadinstitute.org), indicating this variant is rare. At this time, the clinical significance of this variant is uncertain due to the absence of conclusive functional and genetic evidence. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at