7-100952358-CACTGCAAGGGAAACTCCCATAGTGACAGTG-C

Variant names:

• chr7-100952358-CACTGCAAGGGAAACTCCCATAGTGACAGTG-C
• NM_005960.2:c.582_611delTGCAAGGGAAACTCCCATAGTGACAGTGAC

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_005960.2(MUC3A):​c.582_611delTGCAAGGGAAACTCCCATAGTGACAGTGAC​(p.Ala195_Thr204del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 61)
• Consequence: MUC3A NM_005960.2 disruptive_inframe_deletion
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 0.780

Genes affected

MUC3A (HGNC:7513): (mucin 3A, cell surface associated) The mucin genes encode epithelial glycoproteins, some of which are secreted and some membrane bound. Each of the genes contains at least one large domain of tandemly repeated sequence that encodes the peptide sequence rich in serine and/or threonine residues, which carries most of the O-linked glycosylation (Gendler and Spicer, 1995 [PubMed 7778880]).[supplied by OMIM, Aug 2008]

LOC105375431 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_005960.2.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MUC3A	NM_005960.2	c.582_611delTGCAAGGGAAACTCCCATAGTGACAGTGAC	p.Ala195_Thr204del	disruptive_inframe_deletion	Exon 2 of 12	ENST00000379458.9	NP_005951.1
LOC105375431	XR_007060457.1	n.44-5637_44-5608delCACTGTCACTATGGGAGTTTCCCTTGCAGT		intron_variant	Intron 1 of 2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MUC3A	ENST00000379458.9	c.582_611delTGCAAGGGAAACTCCCATAGTGACAGTGAC	p.Ala195_Thr204del	disruptive_inframe_deletion	Exon 2 of 12	5	NM_005960.2	ENSP00000368771.5
MUC3A	ENST00000483366.5	c.582_611delTGCAAGGGAAACTCCCATAGTGACAGTGAC	p.Ala195_Thr204del	disruptive_inframe_deletion	Exon 2 of 11	5		ENSP00000483541.1

Frequencies

GnomAD3 genomes Cov.: 61

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 61

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Lung cancer Pathogenic:1

Jun 15, 2021

Arun Kumar Laboratory, Indian Institute of Science

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: research

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr7-100549998;