7-117535387-TAGGGAGAATGATGATGAAGTAC-T

Position:

• chr7-117535387-TAGGGAGAATGATGATGAAGTAC-T

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_000492.4(CFTR):​c.723_743+1delGAGAATGATGATGAAGTACAGG​(p.Arg242_Arg248del) variant causes a splice donor, disruptive inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.000000684 in 1,461,848 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★★★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 6.8e-7 (0 hom.)
• Consequence: CFTR NM_000492.4 splice_donor, disruptive_inframe_deletion, splice_region, intron
• Clinical Significance: Pathogenic reviewed by expert panel P:4
• Conservation: PhyloP100: 8.40

Genes affected

CFTR (HGNC:1884): (CF transmembrane conductance regulator) This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. The encoded protein functions as a chloride channel, making it unique among members of this protein family, and controls ion and water secretion and absorption in epithelial tissues. Channel activation is mediated by cycles of regulatory domain phosphorylation, ATP-binding by the nucleotide-binding domains, and ATP hydrolysis. Mutations in this gene cause cystic fibrosis, the most common lethal genetic disorder in populations of Northern European descent. The most frequently occurring mutation in cystic fibrosis, DeltaF508, results in impaired folding and trafficking of the encoded protein. Multiple pseudogenes have been identified in the human genome. [provided by RefSeq, Aug 2017]

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 7-117535387-TAGGGAGAATGATGATGAAGTAC-T is Pathogenic according to our data. Variant chr7-117535387-TAGGGAGAATGATGATGAAGTAC-T is described in ClinVar as [Pathogenic]. Clinvar id is 7145.Status of the report is reviewed_by_expert_panel, 3 stars. Variant chr7-117535387-TAGGGAGAATGATGATGAAGTAC-T is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
CFTR	NM_000492.4	c.723_743+1delGAGAATGATGATGAAGTACAGG	p.Arg242_Arg248del	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	6/27	ENST00000003084.11	NP_000483.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
CFTR	ENST00000003084.11	c.723_743+1delGAGAATGATGATGAAGTACAGG	p.Arg242_Arg248del	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	6/27	1	NM_000492.4	ENSP00000003084.6

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 6.84e-7 AC: 1 AN: 1461848 Hom.: 0 AF XY: 0.00000138 AC XY: 1 AN XY: 727230

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 8.99e-7

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:4

Revision: reviewed by expert panel

Submissions by phenotype

Cystic fibrosis Pathogenic:3

Pathogenic, criteria provided, single submitter	curation	CFTR-France	Jan 29, 2018	- -
Pathogenic, reviewed by expert panel	research	CFTR2	Mar 17, 2017	- -
Pathogenic, no assertion criteria provided	literature only	OMIM	Jul 01, 1998	- -

CFTR-related disorder Pathogenic:1

Pathogenic, no assertion criteria provided

clinical testing

Natera, Inc.

Sep 22, 2017

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs121908804; hg19: chr7-117175441;