7-117535387-TAGGGAGAATGATGATGAAGTAC-T
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The ENST00000003084.11(CFTR):c.655_676delGGAGAATGATGATGAAGTACAG(p.Leu219GlufsTer13) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.000000684 in 1,461,848 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★★). Synonymous variant affecting the same amino acid position (i.e. L219L) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
ENST00000003084.11 frameshift
Scores
Clinical Significance
Conservation
Publications
- cystic fibrosisInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), Myriad Women’s Health, Orphanet
- congenital bilateral absence of vas deferensInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- hereditary chronic pancreatitisInheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: ENST00000003084.11. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CFTR | NM_000492.4 | MANE Select | c.723_743+1delGAGAATGATGATGAAGTACAGG | p.Arg242_Arg248del | splice_donor disruptive_inframe_deletion splice_region intron | Exon 6 of 27 | NP_000483.3 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CFTR | ENST00000003084.11 | TSL:1 MANE Select | c.655_676delGGAGAATGATGATGAAGTACAG | p.Leu219GlufsTer13 | frameshift | Exon 6 of 27 | ENSP00000003084.6 | ||
| CFTR | ENST00000699602.1 | c.655_676delGGAGAATGATGATGAAGTACAG | p.Leu219GlufsTer13 | frameshift | Exon 6 of 27 | ENSP00000514471.1 | |||
| CFTR | ENST00000426809.5 | TSL:5 | c.565_586delGGAGAATGATGATGAAGTACAG | p.Leu189GlufsTer13 | frameshift | Exon 5 of 26 | ENSP00000389119.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome AF: 6.84e-7 AC: 1AN: 1461848Hom.: 0 AF XY: 0.00000138 AC XY: 1AN XY: 727230 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Cystic fibrosis Pathogenic:3
CFTR-related disorder Pathogenic:1
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at