rs121908804
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000492.4(CFTR):c.723_743+1delGAGAATGATGATGAAGTACAGG(p.Arg242_Arg248del) variant causes a splice donor, disruptive inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.000000684 in 1,461,848 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★★). Synonymous variant affecting the same amino acid position (i.e. G241G) has been classified as Likely benign.
Frequency
Consequence
NM_000492.4 splice_donor, disruptive_inframe_deletion, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- cystic fibrosisInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Myriad Women’s Health, Laboratory for Molecular Medicine
- congenital bilateral absence of vas deferensInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- hereditary chronic pancreatitisInheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000492.4. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CFTR | TSL:1 MANE Select | c.655_676delGGAGAATGATGATGAAGTACAG | p.Leu219GlufsTer13 | frameshift | Exon 6 of 27 | ENSP00000003084.6 | P13569-1 | ||
| CFTR | c.655_676delGGAGAATGATGATGAAGTACAG | p.Leu219GlufsTer13 | frameshift | Exon 6 of 27 | ENSP00000514471.1 | A0A8V8TNH2 | |||
| CFTR | c.655_676delGGAGAATGATGATGAAGTACAG | p.Leu219GlufsTer13 | frameshift | Exon 6 of 26 | ENSP00000559265.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome AF: 6.84e-7 AC: 1AN: 1461848Hom.: 0 AF XY: 0.00000138 AC XY: 1AN XY: 727230 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at