rs121908804

Variant names:

• chr7-117535387-TAGGGAGAATGATGATGAAGTAC-T
• rs121908804
• ENST00000003084.11:c.655_676delGGAGAATGATGATGAAGTACAG

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The ENST00000003084.11(CFTR):​c.655_676delGGAGAATGATGATGAAGTACAG​(p.Leu219GlufsTer13) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.000000684 in 1,461,848 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★★). Synonymous variant affecting the same amino acid position (i.e. L219L) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 6.8e-7 (0 hom.)
• Consequence: CFTR ENST00000003084.11 frameshift
• Clinical Significance: Pathogenic reviewed by expert panel P:4
• Conservation: PhyloP100: 8.40
• Publications: 4 publications found

Genes affected

CFTR (HGNC:1884): (CF transmembrane conductance regulator) This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. The encoded protein functions as a chloride channel, making it unique among members of this protein family, and controls ion and water secretion and absorption in epithelial tissues. Channel activation is mediated by cycles of regulatory domain phosphorylation, ATP-binding by the nucleotide-binding domains, and ATP hydrolysis. Mutations in this gene cause cystic fibrosis, the most common lethal genetic disorder in populations of Northern European descent. The most frequently occurring mutation in cystic fibrosis, DeltaF508, results in impaired folding and trafficking of the encoded protein. Multiple pseudogenes have been identified in the human genome. [provided by RefSeq, Aug 2017]

CFTR Gene-Disease associations (from GenCC):

• cystic fibrosis

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), Myriad Women’s Health, Orphanet
• congenital bilateral absence of vas deferens

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• hereditary chronic pancreatitis

  Inheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 7-117535387-TAGGGAGAATGATGATGAAGTAC-T is Pathogenic according to our data. Variant chr7-117535387-TAGGGAGAATGATGATGAAGTAC-T is described in ClinVar as Pathogenic. ClinVar VariationId is 7145.Status of the report is reviewed_by_expert_panel, 3 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000003084.11. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CFTR	NM_000492.4	MANE Select	c.723_743+1delGAGAATGATGATGAAGTACAGG	p.Arg242_Arg248del	splice_donor disruptive_inframe_deletion splice_region intron	Exon 6 of 27	NP_000483.3

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CFTR	ENST00000003084.11	TSL:1 MANE Select	c.655_676delGGAGAATGATGATGAAGTACAG	p.Leu219GlufsTer13	frameshift	Exon 6 of 27	ENSP00000003084.6
	CFTR	ENST00000699602.1		c.655_676delGGAGAATGATGATGAAGTACAG	p.Leu219GlufsTer13	frameshift	Exon 6 of 27	ENSP00000514471.1
	CFTR	ENST00000426809.5	TSL:5	c.565_586delGGAGAATGATGATGAAGTACAG	p.Leu189GlufsTer13	frameshift	Exon 5 of 26	ENSP00000389119.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 6.84e-7 AC: 1 AN: 1461848 Hom.: 0 AF XY: 0.00000138 AC XY: 1 AN XY: 727230

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33480

American (AMR) AF: 0.00 AC: 0 AN: 44722

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00 AC: 0 AN: 39696

South Asian (SAS) AF: 0.00 AC: 0 AN: 86256

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53414

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5766

European-Non Finnish (NFE) AF: 8.99e-7 AC: 1 AN: 1111986

Other (OTH) AF: 0.00 AC: 0 AN: 60392

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:4

Revision: reviewed by expert panel

Submissions by phenotype

Cystic fibrosis Pathogenic:3

Mar 17, 2017

CFTR2

Significance: Pathogenic

Review Status: reviewed by expert panel

Collection Method: research

Jan 29, 2018

CFTR-France

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: curation

Jul 01, 1998

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

CFTR-related disorder Pathogenic:1

Sep 22, 2017

Natera, Inc.

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.4
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs121908804; hg19: chr7-117175441;