7-117591983-AAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCC-A

Variant names:

• chr7-117591983-AAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCC-A
• rs121908777
• NM_000492.4:c.1820_1903delTGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAA

Variant summary

Our verdict is Pathogenic. The variant received 13 ACMG points: 13P and 0B. PM1 PM4 PP3 PP5_Very_Strong

The NM_000492.4(CFTR):​c.1820_1903delTGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAA​(p.Met607_Gln634del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000657 in 152,208 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★★).

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0000014 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: CFTR NM_000492.4 disruptive_inframe_deletion
• Clinical Significance: Pathogenic reviewed by expert panel P:10
• Conservation: PhyloP100: 9.23
• Publications: 1 publications found

Genes affected

CFTR (HGNC:1884): (CF transmembrane conductance regulator) This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. The encoded protein functions as a chloride channel, making it unique among members of this protein family, and controls ion and water secretion and absorption in epithelial tissues. Channel activation is mediated by cycles of regulatory domain phosphorylation, ATP-binding by the nucleotide-binding domains, and ATP hydrolysis. Mutations in this gene cause cystic fibrosis, the most common lethal genetic disorder in populations of Northern European descent. The most frequently occurring mutation in cystic fibrosis, DeltaF508, results in impaired folding and trafficking of the encoded protein. Multiple pseudogenes have been identified in the human genome. [provided by RefSeq, Aug 2017]

CFTR Gene-Disease associations (from GenCC):

• cystic fibrosis

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), Myriad Women’s Health, Orphanet
• congenital bilateral absence of vas deferens

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• hereditary chronic pancreatitis

  Inheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Pathogenic. The variant received 13 ACMG points.

• PM1: In a hotspot region, there are 9 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 1 benign, 16 uncertain in NM_000492.4
• PM4: Nonframeshift variant in NON repetitive region in NM_000492.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 7-117591983-AAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCC-A is Pathogenic according to our data. Variant chr7-117591983-AAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCC-A is described in ClinVar as Pathogenic. ClinVar VariationId is 53396.Status of the report is reviewed_by_expert_panel, 3 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CFTR	NM_000492.4	c.1820_1903delTGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAA	p.Met607_Gln634del	disruptive_inframe_deletion	Exon 14 of 27	ENST00000003084.11	NP_000483.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CFTR	ENST00000003084.11	c.1820_1903delTGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAA	p.Met607_Gln634del	disruptive_inframe_deletion	Exon 14 of 27	1	NM_000492.4	ENSP00000003084.6

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152208 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000654

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000138 AC: 2 AN: 1445884 Hom.: 0 AF XY: 0.00000139 AC XY: 1 AN XY: 718610

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 32278

American (AMR) AF: 0.0000246 AC: 1 AN: 40592

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25350

East Asian (EAS) AF: 0.00 AC: 0 AN: 39622

South Asian (SAS) AF: 0.00 AC: 0 AN: 82050

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53026

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5660

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1107704

Other (OTH) AF: 0.0000168 AC: 1 AN: 59602

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152208 Hom.: 0 Cov.: 32 AF XY: 0.0000134 AC XY: 1 AN XY: 74356

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 41456

American (AMR) AF: 0.0000654 AC: 1 AN: 15286

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5198

South Asian (SAS) AF: 0.00 AC: 0 AN: 4830

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10622

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 68024

Other (OTH) AF: 0.00 AC: 0 AN: 2094

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0.000000), which strongly suggests a high chance of mosaicism in these individuals.

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:10

Revision: reviewed by expert panel

Submissions by phenotype

Cystic fibrosis Pathogenic:8

Dec 07, 2020

Johns Hopkins Genomics, Johns Hopkins University

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This CFTR variant is predicted to result in an in-frame deletion of 28 amino acids. It has been identified in multiple individuals with a classic cystic fibrosis phenotype. This variant has been reported in ClinVar. We consider c.1820_1903del to be likely pathogenic. -

Dec 04, 2019

Myriad Genetics, Inc.

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

NM_000492.3(CFTR):c.1820_1903del84(aka M607_Q643del) is classified as likely pathogenic in the context of cystic fibrosis. Sources cited for classification include the following: PMID 1373934, 15371903, 10875853, 15858154, 21520337, 10777364, 21474639 and 1284539. Classification of NM_000492.3(CFTR):c.1820_1903del84(aka M607_Q643del) is based on the following criteria: This variant has been observed more frequently in patients with clinical diagnoses than in healthy populations. Please note: this variant was assessed in the context of healthy population screening. -

Jan 29, 2018

CFTR-France

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: curation

- -

Dec 28, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.1820_1903del, results in the deletion of 28 amino acid(s) of the CFTR protein (p.Met607_Gln634del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with clinical features of cystic fibrosis (PMID: 1373934, 21520337). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. ClinVar contains an entry for this variant (Variation ID: 53396). This variant disrupts the p.Asp614 amino acid residue in CFTR. Other variant(s) that disrupt this residue have been determined to be pathogenic (PMID: 9736778, 12454843, 17413420, 21679131). This suggests that this residue is clinically significant, and that variants that disrupt this residue are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -

Sep 24, 2021

CFTR2

Significance: Pathogenic

Review Status: reviewed by expert panel

Collection Method: research

- -

Mar 03, 2025

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: CFTR c.1820_1903del84 (p.Met607_Gln634del) results in an in-frame deletion that is predicted to remove 28 amino acids from the encoded protein. The variant allele was found at a frequency of 9.3e-06 in 966448 control chromosomes. c.1820_1903del84 has been reported in the literature in multiple individuals affected with Cystic Fibrosis. These data indicate that the variant is very likely to be associated with disease. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. The following publications have been ascertained in the context of this evaluation (PMID: 15371903, 1373934, 17331079, 10777364, 21520337, 21474639, 1284539). ClinVar contains an entry for this variant (Variation ID: 53396). Based on the evidence outlined above, the variant was classified as pathogenic. -

May 01, 1992

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Aug 11, 2023

3billion

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The variant is not observed in the gnomAD v2.1.1 dataset. Predicted Consequence/Location: Inframe deletion located in a nonrepeat region - predicted to change the length of the protein and disrupt normal protein function. The variant has been reported multiple times as an established pathogenic variant (ClinVar ID: VCV000053396 / PMID: 1373934). Therefore, the variant is classified as pathogenic according to the recommendation of ACMG/AMP guideline. -

not provided Pathogenic:1

Sep 21, 2022

Mayo Clinic Laboratories, Mayo Clinic

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Cystic fibrosis;C0238339:Hereditary pancreatitis;C0403814:Congenital bilateral aplasia of vas deferens from CFTR mutation;C2749757:Bronchiectasis with or without elevated sweat chloride 1 Pathogenic:1

Feb 28, 2024

Fulgent Genetics, Fulgent Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.2
Mutation Taster		=3/197	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs121908777; hg19: chr7-117232037;