7-117591983-AAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCC-A

Variant summary

Our verdict is Pathogenic. The variant received 13 ACMG points: 13P and 0B. PM1PM4PP3PP5_Very_Strong

The NM_000492.4(CFTR):​c.1820_1903delTGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAA​(p.Met607_Gln634del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000657 in 152,208 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★★).

Frequency

Genomes: 𝑓 0.0000066 ( 0 hom., cov: 32)
Exomes 𝑓: 0.0000014 ( 0 hom. )
Failed GnomAD Quality Control

Consequence

CFTR
NM_000492.4 disruptive_inframe_deletion

Scores

Not classified

Clinical Significance

Pathogenic reviewed by expert panel P:10

Conservation

PhyloP100: 9.23

Publications

1 publications found
Variant links:
Genes affected
CFTR (HGNC:1884): (CF transmembrane conductance regulator) This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. The encoded protein functions as a chloride channel, making it unique among members of this protein family, and controls ion and water secretion and absorption in epithelial tissues. Channel activation is mediated by cycles of regulatory domain phosphorylation, ATP-binding by the nucleotide-binding domains, and ATP hydrolysis. Mutations in this gene cause cystic fibrosis, the most common lethal genetic disorder in populations of Northern European descent. The most frequently occurring mutation in cystic fibrosis, DeltaF508, results in impaired folding and trafficking of the encoded protein. Multiple pseudogenes have been identified in the human genome. [provided by RefSeq, Aug 2017]
CFTR Gene-Disease associations (from GenCC):
  • cystic fibrosis
    Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), Myriad Women’s Health, Orphanet
  • congenital bilateral absence of vas deferens
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
  • hereditary chronic pancreatitis
    Inheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 13 ACMG points.

PM1
In a hotspot region, there are 9 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 1 benign, 16 uncertain in NM_000492.4
PM4
Nonframeshift variant in NON repetitive region in NM_000492.4.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
PP5
Variant 7-117591983-AAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCC-A is Pathogenic according to our data. Variant chr7-117591983-AAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCC-A is described in ClinVar as Pathogenic. ClinVar VariationId is 53396.Status of the report is reviewed_by_expert_panel, 3 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
CFTRNM_000492.4 linkc.1820_1903delTGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAA p.Met607_Gln634del disruptive_inframe_deletion Exon 14 of 27 ENST00000003084.11 NP_000483.3 P13569-1A0A024R730

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
CFTRENST00000003084.11 linkc.1820_1903delTGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAA p.Met607_Gln634del disruptive_inframe_deletion Exon 14 of 27 1 NM_000492.4 ENSP00000003084.6 P13569-1

Frequencies

GnomAD3 genomes
AF:
0.00000657
AC:
1
AN:
152208
Hom.:
0
Cov.:
32
show subpopulations
Gnomad AFR
AF:
0.00
Gnomad AMI
AF:
0.00
Gnomad AMR
AF:
0.0000654
Gnomad ASJ
AF:
0.00
Gnomad EAS
AF:
0.00
Gnomad SAS
AF:
0.00
Gnomad FIN
AF:
0.00
Gnomad MID
AF:
0.00
Gnomad NFE
AF:
0.00
Gnomad OTH
AF:
0.00
GnomAD4 exome
Data not reliable, filtered out with message: AS_VQSR
AF:
0.00000138
AC:
2
AN:
1445884
Hom.:
0
AF XY:
0.00000139
AC XY:
1
AN XY:
718610
show subpopulations
⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
African (AFR)
AF:
0.00
AC:
0
AN:
32278
American (AMR)
AF:
0.0000246
AC:
1
AN:
40592
Ashkenazi Jewish (ASJ)
AF:
0.00
AC:
0
AN:
25350
East Asian (EAS)
AF:
0.00
AC:
0
AN:
39622
South Asian (SAS)
AF:
0.00
AC:
0
AN:
82050
European-Finnish (FIN)
AF:
0.00
AC:
0
AN:
53026
Middle Eastern (MID)
AF:
0.00
AC:
0
AN:
5660
European-Non Finnish (NFE)
AF:
0.00
AC:
0
AN:
1107704
Other (OTH)
AF:
0.0000168
AC:
1
AN:
59602
⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000), which strongly suggests a high chance of mosaicism in these individuals.
Allele Balance Distribution
Red line indicates average allele balance
Average allele balance: 0.275
Heterozygous variant carriers
0
1
1
2
2
3
0.00
0.20
0.40
0.60
0.80
0.95
Allele balance

Age Distribution

Exome Het
Variant carriers
0
2
4
6
8
10
<30
30-35
35-40
40-45
45-50
50-55
55-60
60-65
65-70
70-75
75-80
>80
Age
GnomAD4 genome
AF:
0.00000657
AC:
1
AN:
152208
Hom.:
0
Cov.:
32
AF XY:
0.0000134
AC XY:
1
AN XY:
74356
show subpopulations
⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.
African (AFR)
AF:
0.00
AC:
0
AN:
41456
American (AMR)
AF:
0.0000654
AC:
1
AN:
15286
Ashkenazi Jewish (ASJ)
AF:
0.00
AC:
0
AN:
3470
East Asian (EAS)
AF:
0.00
AC:
0
AN:
5198
South Asian (SAS)
AF:
0.00
AC:
0
AN:
4830
European-Finnish (FIN)
AF:
0.00
AC:
0
AN:
10622
Middle Eastern (MID)
AF:
0.00
AC:
0
AN:
316
European-Non Finnish (NFE)
AF:
0.00
AC:
0
AN:
68024
Other (OTH)
AF:
0.00
AC:
0
AN:
2094
⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0.000000), which strongly suggests a high chance of mosaicism in these individuals.
Allele Balance Distribution
Red line indicates average allele balance
Average allele balance: 0.375
Heterozygous variant carriers
0
0
1
1
2
2
0.00
0.20
0.40
0.60
0.80
0.95
Allele balance

Age Distribution

Genome Het
Variant carriers
0
2
4
6
8
10
<30
30-35
35-40
40-45
45-50
50-55
55-60
60-65
65-70
70-75
75-80
>80
Age

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:10
Revision: reviewed by expert panel
LINK: link

Submissions by phenotype

Cystic fibrosis Pathogenic:8
Dec 07, 2020
Johns Hopkins Genomics, Johns Hopkins University
Significance:Likely pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This CFTR variant is predicted to result in an in-frame deletion of 28 amino acids. It has been identified in multiple individuals with a classic cystic fibrosis phenotype. This variant has been reported in ClinVar. We consider c.1820_1903del to be likely pathogenic. -

Dec 04, 2019
Myriad Genetics, Inc.
Significance:Likely pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

NM_000492.3(CFTR):c.1820_1903del84(aka M607_Q643del) is classified as likely pathogenic in the context of cystic fibrosis. Sources cited for classification include the following: PMID 1373934, 15371903, 10875853, 15858154, 21520337, 10777364, 21474639 and 1284539. Classification of NM_000492.3(CFTR):c.1820_1903del84(aka M607_Q643del) is based on the following criteria: This variant has been observed more frequently in patients with clinical diagnoses than in healthy populations. Please note: this variant was assessed in the context of healthy population screening. -

Jan 29, 2018
CFTR-France
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:curation

- -

Dec 28, 2023
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This variant, c.1820_1903del, results in the deletion of 28 amino acid(s) of the CFTR protein (p.Met607_Gln634del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with clinical features of cystic fibrosis (PMID: 1373934, 21520337). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. ClinVar contains an entry for this variant (Variation ID: 53396). This variant disrupts the p.Asp614 amino acid residue in CFTR. Other variant(s) that disrupt this residue have been determined to be pathogenic (PMID: 9736778, 12454843, 17413420, 21679131). This suggests that this residue is clinically significant, and that variants that disrupt this residue are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -

Sep 24, 2021
CFTR2
Significance:Pathogenic
Review Status:reviewed by expert panel
Collection Method:research

- -

Mar 03, 2025
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

Variant summary: CFTR c.1820_1903del84 (p.Met607_Gln634del) results in an in-frame deletion that is predicted to remove 28 amino acids from the encoded protein. The variant allele was found at a frequency of 9.3e-06 in 966448 control chromosomes. c.1820_1903del84 has been reported in the literature in multiple individuals affected with Cystic Fibrosis. These data indicate that the variant is very likely to be associated with disease. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. The following publications have been ascertained in the context of this evaluation (PMID: 15371903, 1373934, 17331079, 10777364, 21520337, 21474639, 1284539). ClinVar contains an entry for this variant (Variation ID: 53396). Based on the evidence outlined above, the variant was classified as pathogenic. -

May 01, 1992
OMIM
Significance:Pathogenic
Review Status:no assertion criteria provided
Collection Method:literature only

- -

Aug 11, 2023
3billion
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

The variant is not observed in the gnomAD v2.1.1 dataset. Predicted Consequence/Location: Inframe deletion located in a nonrepeat region - predicted to change the length of the protein and disrupt normal protein function. The variant has been reported multiple times as an established pathogenic variant (ClinVar ID: VCV000053396 / PMID: 1373934). Therefore, the variant is classified as pathogenic according to the recommendation of ACMG/AMP guideline. -

not provided Pathogenic:1
Sep 21, 2022
Mayo Clinic Laboratories, Mayo Clinic
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Cystic fibrosis;C0238339:Hereditary pancreatitis;C0403814:Congenital bilateral aplasia of vas deferens from CFTR mutation;C2749757:Bronchiectasis with or without elevated sweat chloride 1 Pathogenic:1
Feb 28, 2024
Fulgent Genetics, Fulgent Genetics
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
9.2
Mutation Taster
=3/197
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs121908777; hg19: chr7-117232037; API