rs121908777
- chr7-117591983-AAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCC-A
- chr7-117591983-AAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCC-AAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCC
Variant summary
Our verdict is Pathogenic. The variant received 13 ACMG points: 13P and 0B. PM1PM4PP3PP5_Very_Strong
The NM_000492.4(CFTR):c.1820_1903delTGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAA(p.Met607_Gln634del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000657 in 152,208 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★★).
Frequency
Consequence
NM_000492.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- cystic fibrosisInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), Myriad Women’s Health, Orphanet
- congenital bilateral absence of vas deferensInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- hereditary chronic pancreatitisInheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 13 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| CFTR | NM_000492.4 | c.1820_1903delTGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAA | p.Met607_Gln634del | disruptive_inframe_deletion | Exon 14 of 27 | ENST00000003084.11 | NP_000483.3 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| CFTR | ENST00000003084.11 | c.1820_1903delTGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAA | p.Met607_Gln634del | disruptive_inframe_deletion | Exon 14 of 27 | 1 | NM_000492.4 | ENSP00000003084.6 |
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152208Hom.: 0 Cov.: 32 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000138 AC: 2AN: 1445884Hom.: 0 AF XY: 0.00000139 AC XY: 1AN XY: 718610 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152208Hom.: 0 Cov.: 32 AF XY: 0.0000134 AC XY: 1AN XY: 74356 show subpopulations ⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.
Age Distribution
ClinVar
Submissions by phenotype
Cystic fibrosis Pathogenic:8
This CFTR variant is predicted to result in an in-frame deletion of 28 amino acids. It has been identified in multiple individuals with a classic cystic fibrosis phenotype. This variant has been reported in ClinVar. We consider c.1820_1903del to be likely pathogenic. -
NM_000492.3(CFTR):c.1820_1903del84(aka M607_Q643del) is classified as likely pathogenic in the context of cystic fibrosis. Sources cited for classification include the following: PMID 1373934, 15371903, 10875853, 15858154, 21520337, 10777364, 21474639 and 1284539. Classification of NM_000492.3(CFTR):c.1820_1903del84(aka M607_Q643del) is based on the following criteria: This variant has been observed more frequently in patients with clinical diagnoses than in healthy populations. Please note: this variant was assessed in the context of healthy population screening. -
- -
This variant, c.1820_1903del, results in the deletion of 28 amino acid(s) of the CFTR protein (p.Met607_Gln634del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with clinical features of cystic fibrosis (PMID: 1373934, 21520337). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. ClinVar contains an entry for this variant (Variation ID: 53396). This variant disrupts the p.Asp614 amino acid residue in CFTR. Other variant(s) that disrupt this residue have been determined to be pathogenic (PMID: 9736778, 12454843, 17413420, 21679131). This suggests that this residue is clinically significant, and that variants that disrupt this residue are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -
- -
Variant summary: CFTR c.1820_1903del84 (p.Met607_Gln634del) results in an in-frame deletion that is predicted to remove 28 amino acids from the encoded protein. The variant allele was found at a frequency of 9.3e-06 in 966448 control chromosomes. c.1820_1903del84 has been reported in the literature in multiple individuals affected with Cystic Fibrosis. These data indicate that the variant is very likely to be associated with disease. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. The following publications have been ascertained in the context of this evaluation (PMID: 15371903, 1373934, 17331079, 10777364, 21520337, 21474639, 1284539). ClinVar contains an entry for this variant (Variation ID: 53396). Based on the evidence outlined above, the variant was classified as pathogenic. -
- -
The variant is not observed in the gnomAD v2.1.1 dataset. Predicted Consequence/Location: Inframe deletion located in a nonrepeat region - predicted to change the length of the protein and disrupt normal protein function. The variant has been reported multiple times as an established pathogenic variant (ClinVar ID: VCV000053396 / PMID: 1373934). Therefore, the variant is classified as pathogenic according to the recommendation of ACMG/AMP guideline. -
not provided Pathogenic:1
- -
Cystic fibrosis;C0238339:Hereditary pancreatitis;C0403814:Congenital bilateral aplasia of vas deferens from CFTR mutation;C2749757:Bronchiectasis with or without elevated sweat chloride 1 Pathogenic:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at