rs121908777

Variant names:

• chr7-117591983-AAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCC-A
• rs121908777
• NM_000492.4:c.1820_1903delTGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAA

Your query was ambiguous. Multiple possible variants found:

• chr7-117591983-AAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCC-A
• chr7-117591983-AAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCC-AAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCC

Variant summary

Our verdict is Pathogenic. The variant received 13 ACMG points: 13P and 0B. PM1 PM4 PP3 PP5_Very_Strong

The NM_000492.4(CFTR):​c.1820_1903delTGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAA​(p.Met607_Gln634del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000657 in 152,208 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★★).

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0000014 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: CFTR NM_000492.4 disruptive_inframe_deletion
• Clinical Significance: Pathogenic reviewed by expert panel P:10
• Conservation: PhyloP100: 9.23
• Publications: 1 publications found

Genes affected

CFTR (HGNC:1884): (CF transmembrane conductance regulator) This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. The encoded protein functions as a chloride channel, making it unique among members of this protein family, and controls ion and water secretion and absorption in epithelial tissues. Channel activation is mediated by cycles of regulatory domain phosphorylation, ATP-binding by the nucleotide-binding domains, and ATP hydrolysis. Mutations in this gene cause cystic fibrosis, the most common lethal genetic disorder in populations of Northern European descent. The most frequently occurring mutation in cystic fibrosis, DeltaF508, results in impaired folding and trafficking of the encoded protein. Multiple pseudogenes have been identified in the human genome. [provided by RefSeq, Aug 2017]

CFTR Gene-Disease associations (from GenCC):

• cystic fibrosis

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Myriad Women’s Health, Laboratory for Molecular Medicine
• congenital bilateral absence of vas deferens

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• hereditary chronic pancreatitis

  Inheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Pathogenic. The variant received 13 ACMG points.

• PM1: In a hotspot region, there are 9 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 1 benign, 17 uncertain in NM_000492.4
• PM4: Nonframeshift variant in NON repetitive region in NM_000492.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 7-117591983-AAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCC-A is Pathogenic according to our data. Variant chr7-117591983-AAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCC-A is described in ClinVar as Pathogenic. ClinVar VariationId is 53396.Status of the report is reviewed_by_expert_panel, 3 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000492.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CFTR	NM_000492.4	MANE Select	c.1820_1903delTGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAA	p.Met607_Gln634del	disruptive_inframe_deletion	Exon 14 of 27	NP_000483.3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CFTR	ENST00000003084.11	TSL:1 MANE Select	c.1820_1903delTGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAA	p.Met607_Gln634del	disruptive_inframe_deletion	Exon 14 of 27	ENSP00000003084.6	P13569-1
	CFTR	ENST00000699602.1		c.1820_1903delTGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAA	p.Met607_Gln634del	disruptive_inframe_deletion	Exon 14 of 27	ENSP00000514471.1	A0A8V8TNH2
	CFTR	ENST00000889206.1		c.1733_1816delTGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAA	p.Met578_Gln605del	disruptive_inframe_deletion	Exon 13 of 26	ENSP00000559265.1

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152208 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000654

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000138 AC: 2 AN: 1445884 Hom.: 0 AF XY: 0.00000139 AC XY: 1 AN XY: 718610

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 32278

American (AMR) AF: 0.0000246 AC: 1 AN: 40592

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25350

East Asian (EAS) AF: 0.00 AC: 0 AN: 39622

South Asian (SAS) AF: 0.00 AC: 0 AN: 82050

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53026

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5660

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1107704

Other (OTH) AF: 0.0000168 AC: 1 AN: 59602

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152208 Hom.: 0 Cov.: 32 AF XY: 0.0000134 AC XY: 1 AN XY: 74356

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 41456

American (AMR) AF: 0.0000654 AC: 1 AN: 15286

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5198

South Asian (SAS) AF: 0.00 AC: 0 AN: 4830

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10622

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 68024

Other (OTH) AF: 0.00 AC: 0 AN: 2094

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: reviewed by expert panel

Pathogenic	VUS	Benign	Condition
8	-	-	Cystic fibrosis (8)
1	-	-	Cystic fibrosis;C0238339:Hereditary pancreatitis;C0403814:Congenital bilateral aplasia of vas deferens from CFTR mutation;C2749757:Bronchiectasis with or without elevated sweat chloride 1 (1)
1	-	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.2
Mutation Taster		=3/197	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs121908777; hg19: chr7-117232037;