7-135570871-ATATATGTAATATATTATATATTATATATT-A
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_015135.3(NUP205):c.29-228_29-200delGTAATATATTATATATTATATATTTATAT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_015135.3 intron
Scores
Clinical Significance
Conservation
Publications
- nephrotic syndrome, type 13Inheritance: AR Classification: STRONG, LIMITED Submitted by: Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae)
- familial idiopathic steroid-resistant nephrotic syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_015135.3. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| NUP205 | TSL:1 MANE Select | c.29-233_29-205delTATATGTAATATATTATATATTATATATT | intron | N/A | ENSP00000285968.6 | Q92621 | |||
| NUP205 | c.125-233_125-205delTATATGTAATATATTATATATTATATATT | intron | N/A | ENSP00000591614.1 | |||||
| NUP205 | c.29-233_29-205delTATATGTAATATATTATATATTATATATT | intron | N/A | ENSP00000591606.1 |
Frequencies
GnomAD3 genomes Cov.: 21
GnomAD4 genome Cov.: 21
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.