rs1491577075

Variant names:

• chr7-135570871-ATATATGTAATATATTATATATTATATATT-A
• rs1491577075
• NM_015135.3:c.29-228_29-200delGTAATATATTATATATTATATATTTATAT

Your query was ambiguous. Multiple possible variants found:

• chr7-135570871-ATATATGTAATATATTATATATTATATATT-A
• chr7-135570871-ATATATGTAATATATTATATATTATATATT-ATATATGTAATATATTATATATTATATATTTATATGTAATATATTATATATTATATATT
• chr7-135570871-ATATATGTAATATATTATATATTATATATT-ATATATGTAATATATTATATATTATATATTTATATGTAATATATTATATATTATATATTTATATGTAATATATTATATATTATATATT

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_015135.3(NUP205):​c.29-228_29-200delGTAATATATTATATATTATATATTTATAT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 21)
• Consequence: NUP205 NM_015135.3 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 2.21
• Publications: 0 publications found

Genes affected

NUP205 (HGNC:18658): (nucleoporin 205) This gene encodes a nucleoporin, which is a subunit of the nuclear pore complex that functions in active transport of proteins, RNAs and ribonucleoprotein particles between the nucleus and cytoplasm. Mutations in this gene are associated with steroid-resistant nephrotic syndrome. [provided by RefSeq, Jul 2016]

NUP205 Gene-Disease associations (from GenCC):

• nephrotic syndrome, type 13

  Inheritance: AR Classification: STRONG, LIMITED Submitted by: Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae)
• familial idiopathic steroid-resistant nephrotic syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_015135.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NUP205	NM_015135.3	MANE Select	c.29-228_29-200delGTAATATATTATATATTATATATTTATAT		intron	N/A	NP_055950.2	Q92621
	NUP205	NM_001329434.2		c.-1057-228_-1057-200delGTAATATATTATATATTATATATTTATAT		intron	N/A	NP_001316363.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NUP205	ENST00000285968.11	TSL:1 MANE Select	c.29-233_29-205delTATATGTAATATATTATATATTATATATT		intron	N/A	ENSP00000285968.6	Q92621
	NUP205	ENST00000921555.1		c.125-233_125-205delTATATGTAATATATTATATATTATATATT		intron	N/A	ENSP00000591614.1
	NUP205	ENST00000921547.1		c.29-233_29-205delTATATGTAATATATTATATATTATATATT		intron	N/A	ENSP00000591606.1

Frequencies

GnomAD3 genomes Cov.: 21

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 21

Alfa AF: 0.00 Hom.: 126

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.2

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1491577075; hg19: chr7-135255619;