7-150958220-C-CGGGGCGATGGGAGCTGGCCG
Position:
Variant summary
Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong
The NM_000238.4(KCNH2):c.735_754dupCGGCCAGCTCCCATCGCCCC(p.Arg252fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Genomes: not found (cov: 33)
Consequence
KCNH2
NM_000238.4 frameshift
NM_000238.4 frameshift
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 1.14
Genes affected
KCNH2 (HGNC:6251): (potassium voltage-gated channel subfamily H member 2) This gene encodes a component of a voltage-activated potassium channel found in cardiac muscle, nerve cells, and microglia. Four copies of this protein interact with one copy of the KCNE2 protein to form a functional potassium channel. Mutations in this gene can cause long QT syndrome type 2 (LQT2). Transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, May 2022]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 18 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 7-150958220-C-CGGGGCGATGGGAGCTGGCCG is Pathogenic according to our data. Variant chr7-150958220-C-CGGGGCGATGGGAGCTGGCCG is described in ClinVar as [Pathogenic]. Clinvar id is 200612.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
KCNH2 | NM_000238.4 | c.735_754dupCGGCCAGCTCCCATCGCCCC | p.Arg252fs | frameshift_variant | 4/15 | ENST00000262186.10 | NP_000229.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
KCNH2 | ENST00000262186.10 | c.735_754dupCGGCCAGCTCCCATCGCCCC | p.Arg252fs | frameshift_variant | 4/15 | 1 | NM_000238.4 | ENSP00000262186.5 | ||
KCNH2 | ENST00000532957.5 | n.958_977dupCGGCCAGCTCCCATCGCCCC | non_coding_transcript_exon_variant | 4/9 | 2 | |||||
KCNH2 | ENST00000684241.1 | n.1568_1587dupCGGCCAGCTCCCATCGCCCC | non_coding_transcript_exon_variant | 2/13 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD3 genomes
Cov.:
33
GnomAD4 exome Cov.: 31
GnomAD4 exome
Cov.:
31
GnomAD4 genome Cov.: 33
GnomAD4 genome
Cov.:
33
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, multiple submitters, no conflicts
LINK: link
Submissions by phenotype
Long QT syndrome Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Feb 22, 2017 | For these reasons, this variant has been classified as Pathogenic. While this particular variant has not been reported in the literature, truncating variants in KCNH2 are known to be pathogenic (PMID: 19862833). This sequence change duplicates 20 nucleotides in exon 4 of the KCNH2 mRNA (c.735_754dup20), causing a frameshift at codon 252. This creates a premature translational stop signal (p.Arg252Profs*115) and is expected to result in an absent or disrupted protein product. - |
Cardiac arrhythmia Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | GeneDx | Feb 03, 2014 | c.735_754dupCGGCCAGCTCCCATCGCCCC: p.Arg252ProfsX115 (R252PfsX115) in exon 4 of the KCNH2 gene (NM_000238.2). The normal sequence with the bases that are inserted in braces is: GCCCC{CGGCCAGCTCCCATCGCCCC}GGGC. Although thec.735_754dupCGGCCAGCTCCCATCGCCCC mutation in the KCNH2 gene has not been reported to our knowledge, this mutation causes a shift in reading frame starting at codon Arginine 252, changing it to a Proline, and creating a premature stop codon at position 115 of the new reading frame, denoted p.Arg252ProfsX115. This mutation is expected to result in either an abnormal, truncated protein product or loss of protein from this allele through nonsense-mediated mRNA decay. Other frameshift mutations in the KCNH2 gene have been reported in association with LQTS. In summary, c.754_755dup20 in the KCNH2 gene is interpreted as a disease-causing mutation. The variant is found in LQT panel(s). - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at