rs794728425

Positions:

• chr7-150958220-C-CGGGGCGATGGGAGCTGGCCG

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The ENST00000262186.10(KCNH2):​c.754_755insCGGCCAGCTCCCATCGCCCC​(p.Arg252ProfsTer115) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. R252R) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: KCNH2 ENST00000262186.10 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 1.14

Genes affected

KCNH2 (HGNC:6251): (potassium voltage-gated channel subfamily H member 2) This gene encodes a component of a voltage-activated potassium channel found in cardiac muscle, nerve cells, and microglia. Four copies of this protein interact with one copy of the KCNE2 protein to form a functional potassium channel. Mutations in this gene can cause long QT syndrome type 2 (LQT2). Transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, May 2022]

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 7-150958220-C-CGGGGCGATGGGAGCTGGCCG is Pathogenic according to our data. Variant chr7-150958220-C-CGGGGCGATGGGAGCTGGCCG is described in ClinVar as [Pathogenic]. Clinvar id is 200612.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
KCNH2	NM_000238.4	c.754_755insCGGCCAGCTCCCATCGCCCC	p.Arg252ProfsTer115	frameshift_variant	4/15	ENST00000262186.10	NP_000229.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
KCNH2	ENST00000262186.10	c.754_755insCGGCCAGCTCCCATCGCCCC	p.Arg252ProfsTer115	frameshift_variant	4/15	1	NM_000238.4	ENSP00000262186	P1
KCNH2	ENST00000532957.5	n.977_978insCGGCCAGCTCCCATCGCCCC		non_coding_transcript_exon_variant	4/9	2
KCNH2	ENST00000684241.1	n.1587_1588insCGGCCAGCTCCCATCGCCCC		non_coding_transcript_exon_variant	2/13

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Long QT syndrome Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Feb 22, 2017

For these reasons, this variant has been classified as Pathogenic. While this particular variant has not been reported in the literature, truncating variants in KCNH2 are known to be pathogenic (PMID: 19862833). This sequence change duplicates 20 nucleotides in exon 4 of the KCNH2 mRNA (c.735_754dup20), causing a frameshift at codon 252. This creates a premature translational stop signal (p.Arg252Profs*115) and is expected to result in an absent or disrupted protein product. -

Cardiac arrhythmia Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

GeneDx

Feb 03, 2014

c.735_754dupCGGCCAGCTCCCATCGCCCC: p.Arg252ProfsX115 (R252PfsX115) in exon 4 of the KCNH2 gene (NM_000238.2). The normal sequence with the bases that are inserted in braces is: GCCCC{CGGCCAGCTCCCATCGCCCC}GGGC. Although thec.735_754dupCGGCCAGCTCCCATCGCCCC mutation in the KCNH2 gene has not been reported to our knowledge, this mutation causes a shift in reading frame starting at codon Arginine 252, changing it to a Proline, and creating a premature stop codon at position 115 of the new reading frame, denoted p.Arg252ProfsX115. This mutation is expected to result in either an abnormal, truncated protein product or loss of protein from this allele through nonsense-mediated mRNA decay. Other frameshift mutations in the KCNH2 gene have been reported in association with LQTS. In summary, c.754_755dup20 in the KCNH2 gene is interpreted as a disease-causing mutation. The variant is found in LQT panel(s). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs794728425; hg19: chr7-150655308;