7-21687484-CAAGTGAAAATGATTCATGATGCCATCAGAAACAGGAAG-C

Variant names:

• chr7-21687484-CAAGTGAAAATGATTCATGATGCCATCAGAAACAGGAAG-C
• rs1554269295
• NM_001277115.2:c.5885_5922delTGAAAATGATTCATGATGCCATCAGAAACAGGAAGAAG

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_001277115.2(DNAH11):​c.5885_5922delTGAAAATGATTCATGATGCCATCAGAAACAGGAAGAAG​(p.Val1962GlufsTer48) variant causes a frameshift, splice region change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. V1962V) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: DNAH11 NM_001277115.2 frameshift, splice_region
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 9.22
• Publications: 0 publications found

Genes affected

DNAH11 (HGNC:2942): (dynein axonemal heavy chain 11) This gene encodes a ciliary outer dynein arm protein and is a member of the dynein heavy chain family. It is a microtubule-dependent motor ATPase and has been reported to be involved in the movement of respiratory cilia. Mutations in this gene have been implicated in causing Kartagener Syndrome (a combination of situs inversus totalis and Primary Ciliary Dyskinesia (PCD), also called Immotile Cilia Syndrome 1 (ICS1)) and male sterility. [provided by RefSeq, Mar 2013]

DNAH11 Gene-Disease associations (from GenCC):

• primary ciliary dyskinesia 7

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: PanelApp Australia, Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), ClinGen
• primary ciliary dyskinesia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 7-21687484-CAAGTGAAAATGATTCATGATGCCATCAGAAACAGGAAG-C is Pathogenic according to our data. Variant chr7-21687484-CAAGTGAAAATGATTCATGATGCCATCAGAAACAGGAAG-C is described in ClinVar as Pathogenic. ClinVar VariationId is 454689.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
DNAH11	NM_001277115.2	c.5885_5922delTGAAAATGATTCATGATGCCATCAGAAACAGGAAGAAG	p.Val1962GlufsTer48	frameshift_variant, splice_region_variant	Exon 34 of 82	ENST00000409508.8	NP_001264044.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
DNAH11	ENST00000409508.8	c.5885_5922delTGAAAATGATTCATGATGCCATCAGAAACAGGAAGAAG	p.Val1962GlufsTer48	frameshift_variant, splice_region_variant	Exon 34 of 82	5	NM_001277115.2	ENSP00000475939.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Primary ciliary dyskinesia Pathogenic:1

Apr 15, 2017

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change deletes 38 nucleotides from exon 34 of the DNAH11 mRNA (c.5885_5922del), causing a frameshift at codon 1962. This creates a premature translational stop signal (p.Val1962Glufs*48) and is expected to result in an absent or disrupted protein product. While this particular variant has not been reported in the literature, loss-of-function variants in DNAH11 are known to be pathogenic (PMID: 22184204). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.2
Mutation Taster		=7/193	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554269295; hg19: chr7-21727102;