7-33014772-T-TTCATCTTGTACTAAAACAATATCATAAGAGTCC

Position:

• chr7-33014772-T-TTCATCTTGTACTAAAACAATATCATAAGAGTCC

Variant summary

Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PM2 PM4 PP3

The NM_001002010.5(NT5C3A):​c.921_953dupGGACTCTTATGATATTGTTTTAGTACAAGATGA​(p.Glu318_Ser319insAspSerTyrAspIleValLeuValGlnAspGlu) variant causes a disruptive inframe insertion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: NT5C3A NM_001002010.5 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 8.02

Genes affected

NT5C3A (HGNC:17820): (5'-nucleotidase, cytosolic IIIA) This gene encodes a member of the 5'-nucleotidase family of enzymes that catalyze the dephosphorylation of nucleoside 5'-monophosphates. The encoded protein is the type 1 isozyme of pyrimidine 5' nucleotidase and catalyzes the dephosphorylation of pyrimidine 5' monophosphates. Mutations in this gene are a cause of hemolytic anemia due to uridine 5-prime monophosphate hydrolase deficiency. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and pseudogenes of this gene are located on the long arm of chromosomes 3 and 4. [provided by RefSeq, Mar 2012]

NT5C3A (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 5 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_001002010.5.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
NT5C3A	NM_001002010.5	c.921_953dupGGACTCTTATGATATTGTTTTAGTACAAGATGA	p.Glu318_Ser319insAspSerTyrAspIleValLeuValGlnAspGlu	disruptive_inframe_insertion	9/9	ENST00000610140.7	NP_001002010.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
NT5C3A	ENST00000610140.7	c.921_953dupGGACTCTTATGATATTGTTTTAGTACAAGATGA	p.Glu318_Ser319insAspSerTyrAspIleValLeuValGlnAspGlu	disruptive_inframe_insertion	9/9	1	NM_001002010.5	ENSP00000476480.2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Hemolytic anemia due to pyrimidine 5' nucleotidase deficiency Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Revvity Omics, Revvity

Jul 26, 2023

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr7-33054384;