chr7-33014772-T-TTCATCTTGTACTAAAACAATATCATAAGAGTCC

Variant names:

• chr7-33014772-T-TTCATCTTGTACTAAAACAATATCATAAGAGTCC
• NM_001002010.5:c.921_953dupGGACTCTTATGATATTGTTTTAGTACAAGATGA

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4 PP3

The NM_001002010.5(NT5C3A):​c.921_953dupGGACTCTTATGATATTGTTTTAGTACAAGATGA​(p.Glu318_Ser319insAspSerTyrAspIleValLeuValGlnAspGlu) variant causes a disruptive inframe insertion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: NT5C3A NM_001002010.5 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 8.02
• Publications: 0 publications found

Genes affected

NT5C3A (HGNC:17820): (5'-nucleotidase, cytosolic IIIA) This gene encodes a member of the 5'-nucleotidase family of enzymes that catalyze the dephosphorylation of nucleoside 5'-monophosphates. The encoded protein is the type 1 isozyme of pyrimidine 5' nucleotidase and catalyzes the dephosphorylation of pyrimidine 5' monophosphates. Mutations in this gene are a cause of hemolytic anemia due to uridine 5-prime monophosphate hydrolase deficiency. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and pseudogenes of this gene are located on the long arm of chromosomes 3 and 4. [provided by RefSeq, Mar 2012]

NT5C3A Gene-Disease associations (from GenCC):

• hemolytic anemia due to pyrimidine 5' nucleotidase deficiency

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001002010.5.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001002010.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NT5C3A	NM_001002010.5	MANE Select	c.921_953dupGGACTCTTATGATATTGTTTTAGTACAAGATGA	p.Glu318_Ser319insAspSerTyrAspIleValLeuValGlnAspGlu	disruptive_inframe_insertion	Exon 9 of 9	NP_001002010.2	X6RM59
	NT5C3A	NM_001374335.1		c.822_854dupGGACTCTTATGATATTGTTTTAGTACAAGATGA	p.Glu285_Ser286insAspSerTyrAspIleValLeuValGlnAspGlu	disruptive_inframe_insertion	Exon 8 of 8	NP_001361264.1
	NT5C3A	NM_001002009.3		c.819_851dupGGACTCTTATGATATTGTTTTAGTACAAGATGA	p.Glu284_Ser285insAspSerTyrAspIleValLeuValGlnAspGlu	disruptive_inframe_insertion	Exon 10 of 10	NP_001002009.1	Q9H0P0-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NT5C3A	ENST00000610140.7	TSL:1 MANE Select	c.921_953dupGGACTCTTATGATATTGTTTTAGTACAAGATGA	p.Glu318_Ser319insAspSerTyrAspIleValLeuValGlnAspGlu	disruptive_inframe_insertion	Exon 9 of 9	ENSP00000476480.2	X6RM59
	NT5C3A	ENST00000456458.5	TSL:1	n.*826_*858dupGGACTCTTATGATATTGTTTTAGTACAAGATGA		non_coding_transcript_exon	Exon 10 of 10	ENSP00000389676.2	F8WDR0
	NT5C3A	ENST00000456458.5	TSL:1	n.*826_*858dupGGACTCTTATGATATTGTTTTAGTACAAGATGA		3_prime_UTR	Exon 10 of 10	ENSP00000389676.2	F8WDR0

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Hemolytic anemia due to pyrimidine 5' nucleotidase deficiency (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr7-33054384;