7-55174769-CAAGGAATTAAGAGAAGCAAC-AAAGTT

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM1PM4PP3

The NM_005228.5(EGFR):​c.2232_2252delCAAGGAATTAAGAGAAGCAACinsAAAGTT​(p.Glu746_Thr751delinsLeu) variant causes a missense, conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as drug response (★). Synonymous variant affecting the same amino acid position (i.e. I744I) has been classified as Likely benign.

Frequency

Genomes: not found (cov: 33)

Consequence

EGFR
NM_005228.5 missense, conservative_inframe_deletion

Scores

Not classified

Clinical Significance

drug response criteria provided, single submitter O:1

Conservation

PhyloP100: 9.89

Publications

2 publications found
Variant links:
Genes affected
EGFR (HGNC:3236): (epidermal growth factor receptor) The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor, thus inducing receptor dimerization and tyrosine autophosphorylation leading to cell proliferation. Mutations in this gene are associated with lung cancer. EGFR is a component of the cytokine storm which contributes to a severe form of Coronavirus Disease 2019 (COVID-19) resulting from infection with severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2). [provided by RefSeq, Jul 2020]
EGFR Gene-Disease associations (from GenCC):
  • lung cancer
    Inheritance: AD Classification: DEFINITIVE Submitted by: G2P, Ambry Genetics
  • non-small cell lung carcinoma
    Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
  • inflammatory skin and bowel disease, neonatal, 2
    Inheritance: AR Classification: STRONG, MODERATE, LIMITED Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
  • neonatal inflammatory skin and bowel disease
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

PM1
In a hotspot region, there are 3 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 1 benign, 37 uncertain in NM_005228.5
PM4
Nonframeshift variant in NON repetitive region in NM_005228.5.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
EGFRNM_005228.5 linkc.2232_2252delCAAGGAATTAAGAGAAGCAACinsAAAGTT p.Glu746_Thr751delinsLeu missense_variant, conservative_inframe_deletion ENST00000275493.7 NP_005219.2

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
EGFRENST00000275493.7 linkc.2232_2252delCAAGGAATTAAGAGAAGCAACinsAAAGTT p.Glu746_Thr751delinsLeu missense_variant, conservative_inframe_deletion 1 NM_005228.5 ENSP00000275493.2
EGFRENST00000455089.5 linkc.2097_2117delCAAGGAATTAAGAGAAGCAACinsAAAGTT p.Glu701_Thr706delinsLeu missense_variant, conservative_inframe_deletion 1 ENSP00000415559.1
EGFRENST00000450046.2 linkc.2073_2093delCAAGGAATTAAGAGAAGCAACinsAAAGTT p.Glu693_Thr698delinsLeu missense_variant, conservative_inframe_deletion 4 ENSP00000413354.2
EGFRENST00000700145.1 linkc.579_599delCAAGGAATTAAGAGAAGCAACinsAAAGTT p.Glu195_Thr200delinsLeu missense_variant, conservative_inframe_deletion ENSP00000514824.1

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: drug response
Submissions summary: Other:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Tyrosine kinase inhibitor response Other:1
Jun 21, 2011
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine
Significance:drug response
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- Likely Responsive

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
9.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs727504428; hg19: chr7-55242462; API