rs727504428
Variant summary
Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM1PM4PP3
The NM_005228.5(EGFR):c.2232_2252delCAAGGAATTAAGAGAAGCAACinsAAAGTT(p.Glu746_Thr751delinsLeu) variant causes a missense, conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as drug response (★). Synonymous variant affecting the same amino acid position (i.e. I744I) has been classified as Likely benign.
Frequency
Consequence
NM_005228.5 missense, conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- lung cancerInheritance: AD Classification: DEFINITIVE Submitted by: G2P, Ambry Genetics
- non-small cell lung carcinomaInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- inflammatory skin and bowel disease, neonatal, 2Inheritance: AR Classification: STRONG, MODERATE, LIMITED Submitted by: G2P, Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
- neonatal inflammatory skin and bowel diseaseInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 5 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_005228.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| EGFR | MANE Select | c.2232_2252delCAAGGAATTAAGAGAAGCAACinsAAAGTT | p.Glu746_Thr751delinsLeu | missense conservative_inframe_deletion | N/A | NP_005219.2 | |||
| EGFR | c.2097_2117delCAAGGAATTAAGAGAAGCAACinsAAAGTT | p.Glu701_Thr706delinsLeu | missense conservative_inframe_deletion | N/A | NP_001333828.1 | ||||
| EGFR | c.2073_2093delCAAGGAATTAAGAGAAGCAACinsAAAGTT | p.Glu693_Thr698delinsLeu | missense conservative_inframe_deletion | N/A | NP_001333829.1 | C9JYS6 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| EGFR | TSL:1 MANE Select | c.2232_2252delCAAGGAATTAAGAGAAGCAACinsAAAGTT | p.Glu746_Thr751delinsLeu | missense conservative_inframe_deletion | N/A | ENSP00000275493.2 | P00533-1 | ||
| EGFR | TSL:1 | c.2097_2117delCAAGGAATTAAGAGAAGCAACinsAAAGTT | p.Glu701_Thr706delinsLeu | missense conservative_inframe_deletion | N/A | ENSP00000415559.1 | Q504U8 | ||
| EGFR | c.2223_2243delCAAGGAATTAAGAGAAGCAACinsAAAGTT | p.Glu743_Thr748delinsLeu | missense conservative_inframe_deletion | N/A | ENSP00000568258.1 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at