7-55174788-ACATCTCCGAAAGCCAACAAGGAAATC-AAT

Variant names:

• chr7-55174789-CATCTCCGAAAGCCAACAAGGAAATC-AT
• rs397517100
• NM_005228.5:c.2252_2277delCATCTCCGAAAGCCAACAAGGAAATCinsAT

Variant summary

Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PM1 PM4 PP3 PP5

The NM_005228.5(EGFR):​c.2252_2277delCATCTCCGAAAGCCAACAAGGAAATCinsAT​(p.Thr751_Ile759delinsAsn) variant causes a missense, conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (no stars).

• Frequency: Genomes: not found (cov: 33)
• Consequence: EGFR NM_005228.5 missense, conservative_inframe_deletion
• Clinical Significance: Likely pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 9.22
• Publications: 0 publications found

Genes affected

EGFR (HGNC:3236): (epidermal growth factor receptor) The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor, thus inducing receptor dimerization and tyrosine autophosphorylation leading to cell proliferation. Mutations in this gene are associated with lung cancer. EGFR is a component of the cytokine storm which contributes to a severe form of Coronavirus Disease 2019 (COVID-19) resulting from infection with severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2). [provided by RefSeq, Jul 2020]

EGFR Gene-Disease associations (from GenCC):

• lung cancer

  Inheritance: AD Classification: DEFINITIVE Submitted by: G2P, Ambry Genetics
• non-small cell lung carcinoma

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• inflammatory skin and bowel disease, neonatal, 2

  Inheritance: AR Classification: STRONG, MODERATE, LIMITED Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
• neonatal inflammatory skin and bowel disease

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 6 ACMG points.

• PM1: In a hotspot region, there are 2 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 2 benign, 37 uncertain in NM_005228.5
• PM4: Nonframeshift variant in NON repetitive region in NM_005228.5.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 7-55174789-CATCTCCGAAAGCCAACAAGGAAATC-AT is Pathogenic according to our data. Variant chr7-55174789-CATCTCCGAAAGCCAACAAGGAAATC-AT is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 2583127.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
EGFR	NM_005228.5	c.2252_2277delCATCTCCGAAAGCCAACAAGGAAATCinsAT	p.Thr751_Ile759delinsAsn	missense_variant, conservative_inframe_deletion		ENST00000275493.7	NP_005219.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
EGFR	ENST00000275493.7	c.2252_2277delCATCTCCGAAAGCCAACAAGGAAATCinsAT	p.Thr751_Ile759delinsAsn	missense_variant, conservative_inframe_deletion		1	NM_005228.5	ENSP00000275493.2
EGFR	ENST00000455089.5	c.2117_2142delCATCTCCGAAAGCCAACAAGGAAATCinsAT	p.Thr706_Ile714delinsAsn	missense_variant, conservative_inframe_deletion		1		ENSP00000415559.1
EGFR	ENST00000450046.2	c.2093_2118delCATCTCCGAAAGCCAACAAGGAAATCinsAT	p.Thr698_Ile706delinsAsn	missense_variant, conservative_inframe_deletion		4		ENSP00000413354.2
EGFR	ENST00000700145.1	c.599_624delCATCTCCGAAAGCCAACAAGGAAATCinsAT	p.Thr200_Ile208delinsAsn	missense_variant, conservative_inframe_deletion				ENSP00000514824.1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Lung adenocarcinoma Pathogenic:1

-

Key Laboratory of Carcinogenesis and Cancer Invasion, Central South University

Significance: Likely pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.2

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs397517100; hg19: chr7-55242482; COSMIC: COSV51804832;