rs397517100

Variant names:

• chr7-55174789-CATCTCCGAAAGCCAACAAGGAAATC-AA
• rs397517100
• NM_005228.5:c.2252_2277delCATCTCCGAAAGCCAACAAGGAAATCinsAA

Your query was ambiguous. Multiple possible variants found:

• chr7-55174788-ACATCTCCGAAAGCCAACAAGGAAATC-AAA
• chr7-55174788-ACATCTCCGAAAGCCAACAAGGAAATC-AAT

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM1 PM4 PP3

The NM_005228.5(EGFR):​c.2252_2277delCATCTCCGAAAGCCAACAAGGAAATCinsAA​(p.Thr751_Ile759delinsLys) variant causes a missense, conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (no stars).

• Frequency: Genomes: not found (cov: 33)
• Consequence: EGFR NM_005228.5 missense, conservative_inframe_deletion
• Clinical Significance: Uncertain significance no assertion criteria provided U:1
• Conservation: PhyloP100: 9.22
• Publications: 0 publications found

Genes affected

EGFR (HGNC:3236): (epidermal growth factor receptor) The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor, thus inducing receptor dimerization and tyrosine autophosphorylation leading to cell proliferation. Mutations in this gene are associated with lung cancer. EGFR is a component of the cytokine storm which contributes to a severe form of Coronavirus Disease 2019 (COVID-19) resulting from infection with severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2). [provided by RefSeq, Jul 2020]

EGFR Gene-Disease associations (from GenCC):

• lung cancer

  Inheritance: AD Classification: DEFINITIVE Submitted by: Ambry Genetics, G2P
• non-small cell lung carcinoma

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• inflammatory skin and bowel disease, neonatal, 2

  Inheritance: AR Classification: STRONG, MODERATE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P, Genomics England PanelApp
• neonatal inflammatory skin and bowel disease

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

• PM1: In a hotspot region, there are 2 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 2 benign, 37 uncertain in NM_005228.5
• PM4: Nonframeshift variant in NON repetitive region in NM_005228.5.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_005228.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	EGFR	NM_005228.5	MANE Select	c.2252_2277delCATCTCCGAAAGCCAACAAGGAAATCinsAA	p.Thr751_Ile759delinsLys	missense conservative_inframe_deletion	N/A	NP_005219.2
	EGFR	NM_001346899.2		c.2117_2142delCATCTCCGAAAGCCAACAAGGAAATCinsAA	p.Thr706_Ile714delinsLys	missense conservative_inframe_deletion	N/A	NP_001333828.1
	EGFR	NM_001346900.2		c.2093_2118delCATCTCCGAAAGCCAACAAGGAAATCinsAA	p.Thr698_Ile706delinsLys	missense conservative_inframe_deletion	N/A	NP_001333829.1	C9JYS6

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	EGFR	ENST00000275493.7	TSL:1 MANE Select	c.2252_2277delCATCTCCGAAAGCCAACAAGGAAATCinsAA	p.Thr751_Ile759delinsLys	missense conservative_inframe_deletion	N/A	ENSP00000275493.2	P00533-1
	EGFR	ENST00000455089.5	TSL:1	c.2117_2142delCATCTCCGAAAGCCAACAAGGAAATCinsAA	p.Thr706_Ile714delinsLys	missense conservative_inframe_deletion	N/A	ENSP00000415559.1	Q504U8
	EGFR	ENST00000898199.1		c.2243_2268delCATCTCCGAAAGCCAACAAGGAAATCinsAA	p.Thr748_Ile756delinsLys	missense conservative_inframe_deletion	N/A	ENSP00000568258.1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
-	1	-	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.2

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs397517100; hg19: chr7-55242482;