7-99385778-CGTGAGTGCTTGCTGGGGGCCG-C
Position:
Variant summary
Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1PM2
The ENST00000646101.2(ARPC1B):c.64+1_64+21delGTGAGTGCTTGCTGGGGGCCG variant causes a splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Genomes: not found (cov: 31)
Consequence
ARPC1B
ENST00000646101.2 splice_donor, splice_region, intron
ENST00000646101.2 splice_donor, splice_region, intron
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 9.54
Genes affected
ARPC1B (HGNC:704): (actin related protein 2/3 complex subunit 1B) This gene encodes one of seven subunits of the human Arp2/3 protein complex. This subunit is a member of the SOP2 family of proteins and is most similar to the protein encoded by gene ARPC1A. The similarity between these two proteins suggests that they both may function as p41 subunit of the human Arp2/3 complex that has been implicated in the control of actin polymerization in cells. It is possible that the p41 subunit is involved in assembling and maintaining the structure of the Arp2/3 complex. Multiple versions of the p41 subunit may adapt the functions of the complex to different cell types or developmental stages. This protein also has a role in centrosomal homeostasis by being an activator and substrate of the Aurora A kinase. [provided by RefSeq, Mar 2011]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 10 ACMG points.
PVS1
Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
PM2
Very rare variant in population databases, with high coverage;
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
ARPC1B | NM_005720.4 | c.64+4_64+24delAGTGCTTGCTGGGGGCCGGTG | splice_region_variant, intron_variant | ENST00000646101.2 | NP_005711.1 | |||
ARPC1B | XM_024446628.2 | c.64+4_64+24delAGTGCTTGCTGGGGGCCGGTG | splice_region_variant, intron_variant | XP_024302396.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
ARPC1B | ENST00000646101.2 | c.64+1_64+21delGTGAGTGCTTGCTGGGGGCCG | splice_donor_variant, splice_region_variant, intron_variant | NM_005720.4 | ENSP00000496599.1 | |||||
ENSG00000284292 | ENST00000638617.1 | c.1060+1_1060+21delGTGAGTGCTTGCTGGGGGCCG | splice_donor_variant, splice_region_variant, intron_variant | 5 | ENSP00000491073.1 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD3 genomes
Cov.:
31
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 31
GnomAD4 genome
Cov.:
31
ClinVar
Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
not provided Uncertain:1
Uncertain significance, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Dec 25, 2021 | This sequence change falls in intron 2 of the ARPC1B gene. It does not directly change the encoded amino acid sequence of the ARPC1B protein. It affects a nucleotide within the consensus splice site. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with ARPC1B-related conditions. Variants that disrupt the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
Publications
No publications associated with this variant yet.