NM_005720.4:c.64+4_64+24delAGTGCTTGCTGGGGGCCGGTG

Variant summary

Our verdict is Uncertain significance. Variant got 3 ACMG points: 3P and 0B. PM2PP3

The NM_005720.4(ARPC1B):​c.64+4_64+24delAGTGCTTGCTGGGGGCCGGTG variant causes a splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 31)

Consequence

ARPC1B
NM_005720.4 splice_region, intron

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 9.54
Variant links:
Genes affected
ARPC1B (HGNC:704): (actin related protein 2/3 complex subunit 1B) This gene encodes one of seven subunits of the human Arp2/3 protein complex. This subunit is a member of the SOP2 family of proteins and is most similar to the protein encoded by gene ARPC1A. The similarity between these two proteins suggests that they both may function as p41 subunit of the human Arp2/3 complex that has been implicated in the control of actin polymerization in cells. It is possible that the p41 subunit is involved in assembling and maintaining the structure of the Arp2/3 complex. Multiple versions of the p41 subunit may adapt the functions of the complex to different cell types or developmental stages. This protein also has a role in centrosomal homeostasis by being an activator and substrate of the Aurora A kinase. [provided by RefSeq, Mar 2011]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 3 ACMG points.

PM2
Very rare variant in population databases, with high coverage;
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
ARPC1BNM_005720.4 linkc.64+4_64+24delAGTGCTTGCTGGGGGCCGGTG splice_region_variant, intron_variant Intron 2 of 9 ENST00000646101.2 NP_005711.1 O15143A4D275
ARPC1BXM_024446628.2 linkc.64+4_64+24delAGTGCTTGCTGGGGGCCGGTG splice_region_variant, intron_variant Intron 2 of 9 XP_024302396.1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
ARPC1BENST00000646101.2 linkc.64+1_64+21delGTGAGTGCTTGCTGGGGGCCG splice_donor_variant, splice_region_variant, intron_variant Intron 2 of 9 NM_005720.4 ENSP00000496599.1 O15143
ENSG00000284292ENST00000638617.1 linkc.1060+1_1060+21delGTGAGTGCTTGCTGGGGGCCG splice_donor_variant, splice_region_variant, intron_variant Intron 9 of 16 5 ENSP00000491073.1 A0A1W2PNV4

Frequencies

GnomAD3 genomes
Cov.:
31
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
31

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not provided Uncertain:1
Dec 25, 2021
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This sequence change falls in intron 2 of the ARPC1B gene. It does not directly change the encoded amino acid sequence of the ARPC1B protein. It affects a nucleotide within the consensus splice site. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with ARPC1B-related conditions. Variants that disrupt the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr7-98983401; API