NM_005720.4:c.64+4_64+24delAGTGCTTGCTGGGGGCCGGTG
Variant summary
Our verdict is Uncertain significance. Variant got 3 ACMG points: 3P and 0B. PM2PP3
The NM_005720.4(ARPC1B):c.64+4_64+24delAGTGCTTGCTGGGGGCCGGTG variant causes a splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_005720.4 splice_region, intron
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 3 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
ARPC1B | NM_005720.4 | c.64+4_64+24delAGTGCTTGCTGGGGGCCGGTG | splice_region_variant, intron_variant | Intron 2 of 9 | ENST00000646101.2 | NP_005711.1 | ||
ARPC1B | XM_024446628.2 | c.64+4_64+24delAGTGCTTGCTGGGGGCCGGTG | splice_region_variant, intron_variant | Intron 2 of 9 | XP_024302396.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
ARPC1B | ENST00000646101.2 | c.64+1_64+21delGTGAGTGCTTGCTGGGGGCCG | splice_donor_variant, splice_region_variant, intron_variant | Intron 2 of 9 | NM_005720.4 | ENSP00000496599.1 | ||||
ENSG00000284292 | ENST00000638617.1 | c.1060+1_1060+21delGTGAGTGCTTGCTGGGGGCCG | splice_donor_variant, splice_region_variant, intron_variant | Intron 9 of 16 | 5 | ENSP00000491073.1 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 genome Cov.: 31
ClinVar
Submissions by phenotype
not provided Uncertain:1
This sequence change falls in intron 2 of the ARPC1B gene. It does not directly change the encoded amino acid sequence of the ARPC1B protein. It affects a nucleotide within the consensus splice site. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with ARPC1B-related conditions. Variants that disrupt the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
Publications
No publications associated with this variant yet.