8-144513701-C-CGTCAACAGTGCCTGATGAGGA

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_004260.4(RECQL4):​c.2059-10_2069dupTCCTCATCAGGCACTGTTGAC​(p.Thr690_Leu691insProHisGlnAlaLeuLeuThr) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. T690T) has been classified as Likely benign.

Frequency

Genomes: not found (cov: 33)

Consequence

RECQL4
NM_004260.4 disruptive_inframe_insertion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 2.03

Publications

0 publications found
Variant links:
Genes affected
RECQL4 (HGNC:9949): (RecQ like helicase 4) The protein encoded by this gene is a DNA helicase that belongs to the RecQ helicase family. DNA helicases unwind double-stranded DNA into single-stranded DNAs and may modulate chromosome segregation. This gene is predominantly expressed in thymus and testis. Mutations in this gene are associated with Rothmund-Thomson, RAPADILINO and Baller-Gerold syndromes. [provided by RefSeq, Jan 2010]
RECQL4 Gene-Disease associations (from GenCC):
  • Baller-Gerold syndrome
    Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: PanelApp Australia, G2P, Orphanet
  • Rothmund-Thomson syndrome
    Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
  • Rothmund-Thomson syndrome type 2
    Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp, G2P
  • osteosarcoma
    Inheritance: AR Classification: STRONG Submitted by: Genomics England PanelApp
  • rapadilino syndrome
    Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

PM4
Nonframeshift variant in NON repetitive region in NM_004260.4.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
RECQL4NM_004260.4 linkc.2059-10_2069dupTCCTCATCAGGCACTGTTGAC p.Thr690_Leu691insProHisGlnAlaLeuLeuThr disruptive_inframe_insertion Exon 13 of 21 ENST00000617875.6 NP_004251.4 O94761

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
RECQL4ENST00000617875.6 linkc.2059-10_2069dupTCCTCATCAGGCACTGTTGAC p.Thr690_Leu691insProHisGlnAlaLeuLeuThr disruptive_inframe_insertion Exon 13 of 21 1 NM_004260.4 ENSP00000482313.2 O94761

Frequencies

GnomAD3 genomes
Cov.:
33
GnomAD4 exome
Cov.:
47
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Baller-Gerold syndrome Uncertain:1
Oct 13, 2022
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Uncertain significance
Review Status:criteria provided, single submitter
Collection Method:clinical testing

Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. ClinVar contains an entry for this variant (Variation ID: 459368). This variant has not been reported in the literature in individuals affected with RECQL4-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant, c.2059-10_2069dup, results in the insertion of 7 amino acid(s) of the RECQL4 protein (Leu691insProHisGlnAlaLeuLeuThr), but otherwise preserves the integrity of the reading frame. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
2.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1554898831; hg19: chr8-145739085; API