rs1554898831
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_004260.4(RECQL4):c.2059-10_2069dupTCCTCATCAGGCACTGTTGAC(p.Thr690_Leu691insProHisGlnAlaLeuLeuThr) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. T690T) has been classified as Likely benign.
Frequency
Consequence
NM_004260.4 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- Baller-Gerold syndromeInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: PanelApp Australia, G2P, Orphanet
- Rothmund-Thomson syndromeInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- Rothmund-Thomson syndrome type 2Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp, G2P
- osteosarcomaInheritance: AR Classification: STRONG Submitted by: Genomics England PanelApp
- rapadilino syndromeInheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome Cov.: 47
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
Baller-Gerold syndrome Uncertain:1
Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. ClinVar contains an entry for this variant (Variation ID: 459368). This variant has not been reported in the literature in individuals affected with RECQL4-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant, c.2059-10_2069dup, results in the insertion of 7 amino acid(s) of the RECQL4 protein (Leu691insProHisGlnAlaLeuLeuThr), but otherwise preserves the integrity of the reading frame. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at