rs1554898831

Variant names:

• chr8-144513701-C-CGTCAACAGTGCCTGATGAGGA
• rs1554898831
• NM_004260.4:c.2059-10_2069dupTCCTCATCAGGCACTGTTGAC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_004260.4(RECQL4):​c.2059-10_2069dupTCCTCATCAGGCACTGTTGAC​(p.Thr690_Leu691insProHisGlnAlaLeuLeuThr) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. T690T) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 33)
• Consequence: RECQL4 NM_004260.4 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.03
• Publications: 0 publications found

Genes affected

RECQL4 (HGNC:9949): (RecQ like helicase 4) The protein encoded by this gene is a DNA helicase that belongs to the RecQ helicase family. DNA helicases unwind double-stranded DNA into single-stranded DNAs and may modulate chromosome segregation. This gene is predominantly expressed in thymus and testis. Mutations in this gene are associated with Rothmund-Thomson, RAPADILINO and Baller-Gerold syndromes. [provided by RefSeq, Jan 2010]

RECQL4 Gene-Disease associations (from GenCC):

• Baller-Gerold syndrome

  Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, G2P
• Rothmund-Thomson syndrome

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• Rothmund-Thomson syndrome type 2

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet, G2P
• osteosarcoma

  Inheritance: AR Classification: STRONG Submitted by: Genomics England PanelApp
• rapadilino syndrome

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet
• congenital heart disease

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ENSG00000265393 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_004260.4.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_004260.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RECQL4	NM_004260.4	MANE Select	c.2059-10_2069dupTCCTCATCAGGCACTGTTGAC	p.Thr690_Leu691insProHisGlnAlaLeuLeuThr	disruptive_inframe_insertion	Exon 13 of 21	NP_004251.4	O94761
	RECQL4	NM_001413019.1		c.2059-10_2069dupTCCTCATCAGGCACTGTTGAC	p.Thr690_Leu691insProHisGlnAlaLeuLeuThr	disruptive_inframe_insertion	Exon 13 of 20	NP_001399948.1
	RECQL4	NM_001413036.1		c.2059-10_2069dupTCCTCATCAGGCACTGTTGAC	p.Thr690_Leu691insProHisGlnAlaLeuLeuThr	disruptive_inframe_insertion	Exon 13 of 21	NP_001399965.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RECQL4	ENST00000617875.6	TSL:1 MANE Select	c.2069_2070insTCCTCATCAGGCACTGTTGAC	p.Thr690_Leu691insProHisGlnAlaLeuLeuThr	disruptive_inframe_insertion	Exon 13 of 21	ENSP00000482313.2	O94761
	RECQL4	ENST00000621189.4	TSL:1	c.998_999insTCCTCATCAGGCACTGTTGAC	p.Thr333_Leu334insProHisGlnAlaLeuLeuThr	disruptive_inframe_insertion	Exon 12 of 20	ENSP00000483145.1	A0A087X072
	RECQL4	ENST00000971710.1		c.1976_1977insTCCTCATCAGGCACTGTTGAC	p.Thr659_Leu660insProHisGlnAlaLeuLeuThr	disruptive_inframe_insertion	Exon 13 of 21	ENSP00000641769.1

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 47

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Baller-Gerold syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554898831; hg19: chr8-145739085;