rs1554898831

Variant names:

• chr8-144513701-C-CGTCAACAGTGCCTGATGAGGA
• rs1554898831
• NM_004260.4:c.2059-10_2069dupTCCTCATCAGGCACTGTTGAC

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_004260.4(RECQL4):​c.2059-10_2069dupTCCTCATCAGGCACTGTTGAC​(p.Thr690_Leu691insProHisGlnAlaLeuLeuThr) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: RECQL4 NM_004260.4 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.03

Genes affected

RECQL4 (HGNC:9949): (RecQ like helicase 4) The protein encoded by this gene is a DNA helicase that belongs to the RecQ helicase family. DNA helicases unwind double-stranded DNA into single-stranded DNAs and may modulate chromosome segregation. This gene is predominantly expressed in thymus and testis. Mutations in this gene are associated with Rothmund-Thomson, RAPADILINO and Baller-Gerold syndromes. [provided by RefSeq, Jan 2010]

ENSG00000265393 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_004260.4.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RECQL4	NM_004260.4	c.2059-10_2069dupTCCTCATCAGGCACTGTTGAC	p.Thr690_Leu691insProHisGlnAlaLeuLeuThr	disruptive_inframe_insertion	Exon 13 of 21	ENST00000617875.6	NP_004251.4

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RECQL4	ENST00000617875.6	c.2069_2070insTCCTCATCAGGCACTGTTGAC	p.Thr690_Leu691insProHisGlnAlaLeuLeuThr	disruptive_inframe_insertion	Exon 13 of 21	1	NM_004260.4	ENSP00000482313.2

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 47

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Baller-Gerold syndrome Uncertain:1

Oct 13, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. ClinVar contains an entry for this variant (Variation ID: 459368). This variant has not been reported in the literature in individuals affected with RECQL4-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant, c.2059-10_2069dup, results in the insertion of 7 amino acid(s) of the RECQL4 protein (Leu691insProHisGlnAlaLeuLeuThr), but otherwise preserves the integrity of the reading frame. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1554898831; hg19: chr8-145739085;