8-43140525-CGCTGCTGCTGGCCGCGTCCGT-CGCTGCTGCTGGCCGCGTCCGTGCTGCTGCTGGCCGCGTCCGT

Variant names:

• chr8-43140525-C-CGCTGCTGCTGGCCGCGTCCGT
• rs961025173
• NM_152419.3:c.34_54dupCTGCTGGCCGCGTCCGTGCTG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_152419.3(HGSNAT):​c.34_54dupCTGCTGGCCGCGTCCGTGCTG​(p.Leu12_Leu18dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000138 in 1,103,966 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. S19S) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.00011 (0 hom., cov: 32)
  • Exomes 𝑓: 0.00014 (0 hom.)
• Consequence: HGSNAT NM_152419.3 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:4
• Conservation: PhyloP100: 0.718
• Publications: 0 publications found

Genes affected

HGSNAT (HGNC:26527): (heparan-alpha-glucosaminide N-acetyltransferase) This gene encodes a lysosomal acetyltransferase, which is one of several enzymes involved in the lysosomal degradation of heparin sulfate. Mutations in this gene are associated with Sanfilippo syndrome C, one type of the lysosomal storage disease mucopolysaccaridosis III, which results from impaired degradation of heparan sulfate. [provided by RefSeq, Jan 2009]

HGSNAT Gene-Disease associations (from GenCC):

• inherited retinal dystrophy

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• mucopolysaccharidosis type 3

  Inheritance: AR Classification: DEFINITIVE Submitted by: Myriad Women’s Health
• mucopolysaccharidosis type 3C

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp, G2P, ClinGen, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• retinitis pigmentosa 73

  Inheritance: AR Classification: STRONG, MODERATE, LIMITED Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• retinitis pigmentosa

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_152419.3.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_152419.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	HGSNAT	NM_152419.3	MANE Select	c.34_54dupCTGCTGGCCGCGTCCGTGCTG	p.Leu12_Leu18dup	conservative_inframe_insertion	Exon 1 of 18	NP_689632.2
	HGSNAT	NM_001363227.2		c.34_54dupCTGCTGGCCGCGTCCGTGCTG	p.Leu12_Leu18dup	conservative_inframe_insertion	Exon 1 of 19	NP_001350156.1
	HGSNAT	NM_001363228.2		c.34_54dupCTGCTGGCCGCGTCCGTGCTG	p.Leu12_Leu18dup	conservative_inframe_insertion	Exon 1 of 16	NP_001350157.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	HGSNAT	ENST00000379644.9	TSL:2 MANE Select	c.34_54dupCTGCTGGCCGCGTCCGTGCTG	p.Leu12_Leu18dup	conservative_inframe_insertion	Exon 1 of 18	ENSP00000368965.4	Q68CP4-2
	HGSNAT	ENST00000520704.1	TSL:1	n.-117_-97dupCTGCTGGCCGCGTCCGTGCTG		non_coding_transcript_exon	Exon 1 of 10	ENSP00000429109.1	E5RJC4
	HGSNAT	ENST00000520704.1	TSL:1	n.-117_-97dupCTGCTGGCCGCGTCCGTGCTG		5_prime_UTR	Exon 1 of 10	ENSP00000429109.1	E5RJC4

Frequencies

GnomAD3 genomes AF: 0.000108 AC: 16 AN: 148468 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000244

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000134

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000195

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.000142 AC: 136 AN: 955390 Hom.: 0 Cov.: 29 AF XY: 0.000149 AC XY: 67 AN XY: 450448

African (AFR) AF: 0.0000534 AC: 1 AN: 18728

American (AMR) AF: 0.00 AC: 0 AN: 4364

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 9054

East Asian (EAS) AF: 0.00 AC: 0 AN: 13822

South Asian (SAS) AF: 0.00 AC: 0 AN: 18832

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 11706

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 2244

European-Non Finnish (NFE) AF: 0.000157 AC: 132 AN: 841914

Other (OTH) AF: 0.0000864 AC: 3 AN: 34726

GnomAD4 genome AF: 0.000108 AC: 16 AN: 148576 Hom.: 0 Cov.: 32 AF XY: 0.000124 AC XY: 9 AN XY: 72470

African (AFR) AF: 0.0000243 AC: 1 AN: 41162

American (AMR) AF: 0.000134 AC: 2 AN: 14950

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3410

East Asian (EAS) AF: 0.00 AC: 0 AN: 5140

South Asian (SAS) AF: 0.00 AC: 0 AN: 4820

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 9182

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 290

European-Non Finnish (NFE) AF: 0.000195 AC: 13 AN: 66640

Other (OTH) AF: 0.00 AC: 0 AN: 2070

Alfa AF: 0.0000843 Hom.: 0

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	2	-	Mucopolysaccharidosis, MPS-III-C (2)
-	1	-	Mucopolysaccharidosis, MPS-III-C;C4225287:Retinitis pigmentosa 73 (1)
-	1	-	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.72
Mutation Taster		=75/25	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs961025173; hg19: chr8-42995668;