rs961025173
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_152419.3(HGSNAT):c.34_54delCTGCTGGCCGCGTCCGTGCTG(p.Leu12_Leu18del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (no stars). Synonymous variant affecting the same amino acid position (i.e. L12L) has been classified as Likely benign.
Frequency
Consequence
NM_152419.3 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- inherited retinal dystrophyInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- mucopolysaccharidosis type 3Inheritance: AR Classification: DEFINITIVE Submitted by: Myriad Women’s Health
- mucopolysaccharidosis type 3CInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp, G2P, ClinGen, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- retinitis pigmentosa 73Inheritance: AR Classification: STRONG, MODERATE, LIMITED Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- retinitis pigmentosaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_152419.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| HGSNAT | MANE Select | c.34_54delCTGCTGGCCGCGTCCGTGCTG | p.Leu12_Leu18del | conservative_inframe_deletion | Exon 1 of 18 | NP_689632.2 | |||
| HGSNAT | c.34_54delCTGCTGGCCGCGTCCGTGCTG | p.Leu12_Leu18del | conservative_inframe_deletion | Exon 1 of 19 | NP_001350156.1 | ||||
| HGSNAT | c.34_54delCTGCTGGCCGCGTCCGTGCTG | p.Leu12_Leu18del | conservative_inframe_deletion | Exon 1 of 16 | NP_001350157.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| HGSNAT | TSL:2 MANE Select | c.34_54delCTGCTGGCCGCGTCCGTGCTG | p.Leu12_Leu18del | conservative_inframe_deletion | Exon 1 of 18 | ENSP00000368965.4 | Q68CP4-2 | ||
| HGSNAT | TSL:1 | n.-117_-97delCTGCTGGCCGCGTCCGTGCTG | non_coding_transcript_exon | Exon 1 of 10 | ENSP00000429109.1 | E5RJC4 | |||
| HGSNAT | TSL:1 | n.-117_-97delCTGCTGGCCGCGTCCGTGCTG | 5_prime_UTR | Exon 1 of 10 | ENSP00000429109.1 | E5RJC4 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at