rs961025173

Variant names:

• chr8-43140525-CGCTGCTGCTGGCCGCGTCCGT-C
• rs961025173
• NM_152419.3:c.34_54delCTGCTGGCCGCGTCCGTGCTG

Your query was ambiguous. Multiple possible variants found:

• chr8-43140525-CGCTGCTGCTGGCCGCGTCCGT-C
• chr8-43140525-CGCTGCTGCTGGCCGCGTCCGT-CGCTGCTGCTGGCCGCGTCCGTGCTGCTGCTGGCCGCGTCCGT

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_152419.3(HGSNAT):​c.34_54delCTGCTGGCCGCGTCCGTGCTG​(p.Leu12_Leu18del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (no stars). Synonymous variant affecting the same amino acid position (i.e. L12L) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: HGSNAT NM_152419.3 conservative_inframe_deletion
• Clinical Significance: Uncertain significance no assertion criteria provided U:1
• Conservation: PhyloP100: 2.11
• Publications: 0 publications found

Genes affected

HGSNAT (HGNC:26527): (heparan-alpha-glucosaminide N-acetyltransferase) This gene encodes a lysosomal acetyltransferase, which is one of several enzymes involved in the lysosomal degradation of heparin sulfate. Mutations in this gene are associated with Sanfilippo syndrome C, one type of the lysosomal storage disease mucopolysaccaridosis III, which results from impaired degradation of heparan sulfate. [provided by RefSeq, Jan 2009]

HGSNAT Gene-Disease associations (from GenCC):

• inherited retinal dystrophy

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• mucopolysaccharidosis type 3

  Inheritance: AR Classification: DEFINITIVE Submitted by: Myriad Women’s Health
• mucopolysaccharidosis type 3C

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp, G2P, ClinGen, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• retinitis pigmentosa 73

  Inheritance: AR Classification: STRONG, MODERATE, LIMITED Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• retinitis pigmentosa

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_152419.3.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_152419.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	HGSNAT	NM_152419.3	MANE Select	c.34_54delCTGCTGGCCGCGTCCGTGCTG	p.Leu12_Leu18del	conservative_inframe_deletion	Exon 1 of 18	NP_689632.2
	HGSNAT	NM_001363227.2		c.34_54delCTGCTGGCCGCGTCCGTGCTG	p.Leu12_Leu18del	conservative_inframe_deletion	Exon 1 of 19	NP_001350156.1
	HGSNAT	NM_001363228.2		c.34_54delCTGCTGGCCGCGTCCGTGCTG	p.Leu12_Leu18del	conservative_inframe_deletion	Exon 1 of 16	NP_001350157.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	HGSNAT	ENST00000379644.9	TSL:2 MANE Select	c.34_54delCTGCTGGCCGCGTCCGTGCTG	p.Leu12_Leu18del	conservative_inframe_deletion	Exon 1 of 18	ENSP00000368965.4	Q68CP4-2
	HGSNAT	ENST00000520704.1	TSL:1	n.-117_-97delCTGCTGGCCGCGTCCGTGCTG		non_coding_transcript_exon	Exon 1 of 10	ENSP00000429109.1	E5RJC4
	HGSNAT	ENST00000520704.1	TSL:1	n.-117_-97delCTGCTGGCCGCGTCCGTGCTG		5_prime_UTR	Exon 1 of 10	ENSP00000429109.1	E5RJC4

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
-	1	-	Mucopolysaccharidosis, MPS-III-C (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.1

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs961025173; hg19: chr8-42995668;