rs961025173

Variant names:

• chr8-43140525-CGCTGCTGCTGGCCGCGTCCGT-C
• rs961025173
• NM_152419.3:c.34_54delCTGCTGGCCGCGTCCGTGCTG

Your query was ambiguous. Multiple possible variants found:

• chr8-43140525-CGCTGCTGCTGGCCGCGTCCGT-C
• chr8-43140525-CGCTGCTGCTGGCCGCGTCCGT-CGCTGCTGCTGGCCGCGTCCGTGCTGCTGCTGGCCGCGTCCGT

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PM1 PM2 PM4

The NM_152419.3(HGSNAT):​c.34_54delCTGCTGGCCGCGTCCGTGCTG​(p.Leu12_Leu18del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 32)
• Consequence: HGSNAT NM_152419.3 conservative_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 2.11

Genes affected

HGSNAT (HGNC:26527): (heparan-alpha-glucosaminide N-acetyltransferase) This gene encodes a lysosomal acetyltransferase, which is one of several enzymes involved in the lysosomal degradation of heparin sulfate. Mutations in this gene are associated with Sanfilippo syndrome C, one type of the lysosomal storage disease mucopolysaccaridosis III, which results from impaired degradation of heparan sulfate. [provided by RefSeq, Jan 2009]

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PM1: In a topological_domain Lumenal, vesicle (size 189) in uniprot entity HGNAT_HUMAN there are 13 pathogenic changes around while only 1 benign (93%) in NM_152419.3
• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_152419.3.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
HGSNAT	NM_152419.3	c.34_54delCTGCTGGCCGCGTCCGTGCTG	p.Leu12_Leu18del	conservative_inframe_deletion	Exon 1 of 18	ENST00000379644.9	NP_689632.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
HGSNAT	ENST00000379644.9	c.34_54delCTGCTGGCCGCGTCCGTGCTG	p.Leu12_Leu18del	conservative_inframe_deletion	Exon 1 of 18	2	NM_152419.3	ENSP00000368965.4
HGSNAT	ENST00000520704.1	n.-117_-97delCTGCTGGCCGCGTCCGTGCTG		non_coding_transcript_exon_variant	Exon 1 of 10	1		ENSP00000429109.1
HGSNAT	ENST00000520704.1	n.-117_-97delCTGCTGGCCGCGTCCGTGCTG		5_prime_UTR_variant	Exon 1 of 10	1		ENSP00000429109.1
HGSNAT	ENST00000517319.1	n.34_54delCTGCTGGCCGCGTCCGTGCTG		non_coding_transcript_exon_variant	Exon 1 of 5	4		ENSP00000430032.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs961025173; hg19: chr8-42995668;