8-73976203-G-GGCAGTCGGGTGGGAAGCCGTGTCTC
Variant summary
Our verdict is Benign. Variant got -10 ACMG points: 0P and 10B. BP6_ModerateBS1BS2
The NM_017866.6(TMEM70):c.-71_-47dupGGTGGGAAGCCGTGTCTCGCAGTCG variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000336 in 1,364,592 control chromosomes in the GnomAD database, including 6 homozygotes. Variant has been reported in ClinVar as Likely benign (★).
Frequency
Consequence
NM_017866.6 5_prime_UTR
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Benign. Variant got -10 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
TMEM70 | NM_017866.6 | c.-71_-47dupGGTGGGAAGCCGTGTCTCGCAGTCG | 5_prime_UTR_variant | Exon 1 of 3 | ENST00000312184.6 | NP_060336.3 | ||
TMEM70 | NM_001040613.3 | c.-71_-47dupGGTGGGAAGCCGTGTCTCGCAGTCG | 5_prime_UTR_variant | Exon 1 of 3 | NP_001035703.1 | |||
TMEM70 | NR_033334.2 | n.17_41dupGGTGGGAAGCCGTGTCTCGCAGTCG | non_coding_transcript_exon_variant | Exon 1 of 4 |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.000296 AC: 45AN: 152080Hom.: 2 Cov.: 32
GnomAD3 exomes AF: 0.000554 AC: 87AN: 157080Hom.: 0 AF XY: 0.000418 AC XY: 36AN XY: 86110
GnomAD4 exome AF: 0.000341 AC: 414AN: 1212394Hom.: 4 Cov.: 17 AF XY: 0.000322 AC XY: 196AN XY: 608754
GnomAD4 genome AF: 0.000296 AC: 45AN: 152198Hom.: 2 Cov.: 32 AF XY: 0.000269 AC XY: 20AN XY: 74428
ClinVar
Submissions by phenotype
not specified Benign:1
This variant is considered likely benign or benign based on one or more of the following criteria: it is a conservative change, it occurs at a poorly conserved position in the protein, it is predicted to be benign by multiple in silico algorithms, and/or has population frequency not consistent with disease. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at