9-121286733-GAGAGCTGATCTTCATGCCACTGTGTACAGT-G

Position:

• chr9-121286733-GAGAGCTGATCTTCATGCCACTGTGTACAGT-G

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PVS1_Moderate PM2

The NM_001353071.2(GSN):​c.-73_-48+4delAGCTGATCTTCATGCCACTGTGTACAGTAG variant causes a splice donor, splice region, 5 prime UTR, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: GSN NM_001353071.2 splice_donor, splice_region, 5_prime_UTR, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.16

Genes affected

GSN (HGNC:4620): (gelsolin) The protein encoded by this gene binds to the "plus" ends of actin monomers and filaments to prevent monomer exchange. The encoded calcium-regulated protein functions in both assembly and disassembly of actin filaments. Defects in this gene are a cause of familial amyloidosis Finnish type (FAF). Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

GSN (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.07133244 fraction of the gene. Cryptic splice site detected, with MaxEntScore 3.2, offset of -3, new splice context is: gaaGTgaga. Cryptic site results in inframe change. If cryptic site found is not functional and variant results in exon loss, it results in frameshift change.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
GSN	NM_198252.3	c.-10+5174_-10+5203delAGCTGATCTTCATGCCACTGTGTACAGTAG		intron_variant		ENST00000432226.7	NP_937895.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
GSN	ENST00000432226.7	c.-10+5174_-10+5203delAGCTGATCTTCATGCCACTGTGTACAGTAG		intron_variant		5	NM_198252.3	ENSP00000404226.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

CeGaT Center for Human Genetics Tuebingen

Oct 01, 2023

GSN: PM2 -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr9-124049011;